ID: 928443323

View in Genome Browser
Species Human (GRCh38)
Location 2:31311698-31311720
Sequence CAGGAGACTCAGAGCCCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928443317_928443323 6 Left 928443317 2:31311669-31311691 CCCTGTCAGACAAGTCTGAAATA No data
Right 928443323 2:31311698-31311720 CAGGAGACTCAGAGCCCACAGGG No data
928443314_928443323 15 Left 928443314 2:31311660-31311682 CCCAAGGACCCCTGTCAGACAAG No data
Right 928443323 2:31311698-31311720 CAGGAGACTCAGAGCCCACAGGG No data
928443318_928443323 5 Left 928443318 2:31311670-31311692 CCTGTCAGACAAGTCTGAAATAG No data
Right 928443323 2:31311698-31311720 CAGGAGACTCAGAGCCCACAGGG No data
928443313_928443323 16 Left 928443313 2:31311659-31311681 CCCCAAGGACCCCTGTCAGACAA No data
Right 928443323 2:31311698-31311720 CAGGAGACTCAGAGCCCACAGGG No data
928443312_928443323 19 Left 928443312 2:31311656-31311678 CCTCCCCAAGGACCCCTGTCAGA No data
Right 928443323 2:31311698-31311720 CAGGAGACTCAGAGCCCACAGGG No data
928443315_928443323 14 Left 928443315 2:31311661-31311683 CCAAGGACCCCTGTCAGACAAGT No data
Right 928443323 2:31311698-31311720 CAGGAGACTCAGAGCCCACAGGG No data
928443316_928443323 7 Left 928443316 2:31311668-31311690 CCCCTGTCAGACAAGTCTGAAAT No data
Right 928443323 2:31311698-31311720 CAGGAGACTCAGAGCCCACAGGG No data
928443311_928443323 20 Left 928443311 2:31311655-31311677 CCCTCCCCAAGGACCCCTGTCAG No data
Right 928443323 2:31311698-31311720 CAGGAGACTCAGAGCCCACAGGG No data
928443310_928443323 21 Left 928443310 2:31311654-31311676 CCCCTCCCCAAGGACCCCTGTCA No data
Right 928443323 2:31311698-31311720 CAGGAGACTCAGAGCCCACAGGG No data
928443309_928443323 24 Left 928443309 2:31311651-31311673 CCTCCCCTCCCCAAGGACCCCTG No data
Right 928443323 2:31311698-31311720 CAGGAGACTCAGAGCCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928443323 Original CRISPR CAGGAGACTCAGAGCCCACA GGG Intergenic
No off target data available for this crispr