ID: 928443992

View in Genome Browser
Species Human (GRCh38)
Location 2:31316957-31316979
Sequence ATGTTTCCTATTAAGATCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928443991_928443992 24 Left 928443991 2:31316910-31316932 CCAACTCTTTGCAAAATTATAGT No data
Right 928443992 2:31316957-31316979 ATGTTTCCTATTAAGATCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928443992 Original CRISPR ATGTTTCCTATTAAGATCTA AGG Intergenic
No off target data available for this crispr