ID: 928445915

View in Genome Browser
Species Human (GRCh38)
Location 2:31333165-31333187
Sequence CAGGCTGAGGATTCTCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928445915_928445920 -3 Left 928445915 2:31333165-31333187 CCAGCAAGAGAATCCTCAGCCTG 0: 1
1: 0
2: 0
3: 13
4: 157
Right 928445920 2:31333185-31333207 CTGCCTATAAATGAAACGGTGGG 0: 1
1: 0
2: 1
3: 8
4: 73
928445915_928445922 5 Left 928445915 2:31333165-31333187 CCAGCAAGAGAATCCTCAGCCTG 0: 1
1: 0
2: 0
3: 13
4: 157
Right 928445922 2:31333193-31333215 AAATGAAACGGTGGGCATCCTGG 0: 1
1: 1
2: 1
3: 6
4: 94
928445915_928445917 -7 Left 928445915 2:31333165-31333187 CCAGCAAGAGAATCCTCAGCCTG 0: 1
1: 0
2: 0
3: 13
4: 157
Right 928445917 2:31333181-31333203 CAGCCTGCCTATAAATGAAACGG 0: 1
1: 0
2: 2
3: 18
4: 174
928445915_928445919 -4 Left 928445915 2:31333165-31333187 CCAGCAAGAGAATCCTCAGCCTG 0: 1
1: 0
2: 0
3: 13
4: 157
Right 928445919 2:31333184-31333206 CCTGCCTATAAATGAAACGGTGG 0: 1
1: 0
2: 0
3: 2
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928445915 Original CRISPR CAGGCTGAGGATTCTCTTGC TGG (reversed) Intergenic
901187434 1:7384107-7384129 AAAGCTGTGGCTTCTCTTGCAGG + Intronic
901293850 1:8145689-8145711 CAGGATGAGGGCTCTCTTCCTGG - Intergenic
902706673 1:18210115-18210137 TAGGCTGATGTTTCTCTTGCTGG + Intronic
903112666 1:21150084-21150106 CTGGCTCAGGATTCTCTTAATGG - Intronic
905317791 1:37094630-37094652 CAGCCTGTGGATGCTCTTGCAGG - Intergenic
905905475 1:41615378-41615400 CAGGCTGAGGGTTCTCCAGGTGG - Intronic
906490873 1:46267437-46267459 CTGAATAAGGATTCTCTTGCAGG + Exonic
915234200 1:154468658-154468680 CAGGTTGTGGAATCTGTTGCTGG + Exonic
916584158 1:166135632-166135654 CACTCTGAGTATTCTTTTGCAGG + Intronic
917508736 1:175651592-175651614 CAGGCCTAGGATTCTCTGGAAGG - Intronic
917622099 1:176807038-176807060 TAGACTGAGTTTTCTCTTGCGGG - Intronic
918152774 1:181812606-181812628 CAAGCTGAGGATTATTTTCCCGG - Intergenic
918390397 1:184053638-184053660 CAGCCTCAGAATTCTCCTGCAGG + Intronic
920249126 1:204610892-204610914 CAGGCGGAGGGTTCTTTGGCTGG + Intergenic
922203165 1:223424086-223424108 CACCCTGAGGGCTCTCTTGCTGG + Intergenic
1063718958 10:8559011-8559033 ATGGCTGAGGAGACTCTTGCAGG - Intergenic
1064155007 10:12896729-12896751 TAGGCTGACCATTCCCTTGCGGG + Exonic
1065296649 10:24282274-24282296 GAGGCTGAGGAGTCTTTTTCAGG + Intronic
1066049548 10:31621073-31621095 CAGGCTGAGGGGTCACTGGCAGG - Intergenic
1069534384 10:69242126-69242148 CAGGCTGAGGAGGGTCTTGAGGG - Intronic
1071259848 10:83909763-83909785 CAGGCTGATGGTTCTTTTGAGGG + Intergenic
1074207977 10:111301070-111301092 GAGGCTGAGGAGTCTCATGATGG + Intergenic
1076572621 10:131442517-131442539 CCGGCTGAGGATGGTCCTGCTGG + Intergenic
1076882324 10:133245667-133245689 CCTGCTGGGGAGTCTCTTGCAGG - Intergenic
1077608349 11:3627333-3627355 CAGGCTGAGGATTCCCAGGGAGG - Intergenic
1079003543 11:16777016-16777038 CAGGCTGTGGACTCCCTTGTGGG - Intergenic
1079172838 11:18112696-18112718 CATGCAGAGGATTCGCTGGCTGG - Intronic
1082888215 11:58110791-58110813 CAGGCTGATTATTCCCTTTCTGG + Intronic
1084873472 11:72113368-72113390 CAGGCACAGCATTCTGTTGCTGG + Intergenic
1085055313 11:73399722-73399744 CAGGCCCAGGCTTCTCTTACTGG - Intergenic
1085379660 11:76103161-76103183 CAAGCAGAGGTTTCTCTGGCTGG - Intronic
1087703141 11:101459744-101459766 CAGGATGAGTATTTTCTTACTGG + Intronic
1090973986 11:131666681-131666703 GAGGCTGAGGACTCTGTTGTGGG - Intronic
1093473160 12:19526745-19526767 TAGTCTGAGGATTATCTTTCTGG - Intronic
1095494551 12:42770985-42771007 GATGCTGAGGATTGACTTGCAGG - Intergenic
1097159479 12:57036193-57036215 CAGACTGAGGAAACTCTTGGGGG + Intronic
1100559691 12:95735659-95735681 CAGGCTGATAATTTTCTTGCTGG + Intronic
1102380697 12:112464323-112464345 CAGGTTGATGATTTTCTTGTAGG + Intronic
1103227470 12:119300614-119300636 CAGGCTGAGCAGCCTCTTCCTGG + Intergenic
1104019008 12:124979431-124979453 CAGGATGAGTATTCTGTTGCTGG - Intronic
1104212437 12:126702203-126702225 CAGGCTGATCAGTCTCTTGTTGG + Intergenic
1111996222 13:95168391-95168413 AAGGGTGAGAATTCACTTGCCGG + Intronic
1113448004 13:110385331-110385353 CAGGATGAGGATTTTCTTCATGG - Intronic
1114568617 14:23650124-23650146 CAGCCTGAGGGTTCTCTGTCTGG + Intergenic
1114990939 14:28288681-28288703 CAGTGTGAAGATTCTCATGCTGG - Intergenic
1115625572 14:35188560-35188582 CAGGCTTTGGATTCTCTTTTCGG + Intronic
1119085316 14:71733659-71733681 GAGGCTGAGAACTCTCCTGCGGG - Exonic
1120275023 14:82361899-82361921 CATAATGAGGATTCTCTTGTTGG + Intergenic
1121525797 14:94618429-94618451 CAGGCTGAGGATTCAACTGTGGG - Intronic
1124575241 15:30902311-30902333 CAGGCAGAAGATTATCTAGCAGG - Intergenic
1128888175 15:71307424-71307446 AAGGCTGAGGATGATCTTGAGGG - Intronic
1131228796 15:90645958-90645980 CGGGCTGAGCTTTCTGTTGCTGG + Intergenic
1131468729 15:92676591-92676613 CTGGTTGAGGATTCTCTTCCAGG - Intronic
1132085771 15:98907275-98907297 CAGGCTGAGGATTGACCAGCTGG + Intronic
1132334534 15:101037537-101037559 CAGCCTGAGCATTCCATTGCTGG - Intronic
1133021273 16:2967937-2967959 CAGGCTGAGGGTTCTGCCGCGGG + Exonic
1135160713 16:20093558-20093580 CAGGCTGACTCTTCTCTTGGAGG + Intergenic
1138572196 16:57882995-57883017 CAGGCAGAGGATGCTCCTACCGG + Exonic
1139953489 16:70682786-70682808 AAGGCTGAGGATGCTGTTCCTGG - Intronic
1142714121 17:1738737-1738759 CAGCCTGAGGCTTATCTTGCTGG + Intergenic
1143947047 17:10602452-10602474 CAGTCTGTGGTTTCTCTGGCTGG + Intergenic
1145985518 17:29043312-29043334 CAGGAAGAGGATCCTCCTGCTGG + Exonic
1146651422 17:34609207-34609229 CAGCCGGAGGCTTCTCTTCCAGG - Intronic
1147625489 17:41897269-41897291 CAGGCGGGGGCTTTTCTTGCTGG + Intronic
1147662680 17:42125373-42125395 GAGGATGTGGATGCTCTTGCTGG + Intronic
1149605549 17:57922488-57922510 CTGGCTGAGGATTCTCTTCTCGG - Intronic
1151715973 17:75831242-75831264 CAGGCTGAAGATTGCCCTGCAGG - Exonic
1155260514 18:24037945-24037967 CAGGCTGAGGCCTCACCTGCAGG - Intronic
1163470935 19:17496586-17496608 CAGGCTGAGGGTTGCCCTGCGGG + Intronic
1165755500 19:38290515-38290537 CAGGCTGTGTGTTCTCTTCCAGG + Exonic
925599001 2:5589087-5589109 CCTTCTGAGGATTCTCTTTCAGG - Intergenic
926915089 2:17883626-17883648 CAGGCTGAGGATTCTAAGGCAGG + Intronic
927706459 2:25299349-25299371 CAGGCTGAGGAGTCTCTGTGAGG - Intronic
928089313 2:28364324-28364346 GAGGCAGAGGATTCTCCTGAGGG - Intergenic
928181476 2:29071562-29071584 CAGGCTGGCGGTGCTCTTGCTGG + Exonic
928445915 2:31333165-31333187 CAGGCTGAGGATTCTCTTGCTGG - Intergenic
929597470 2:43185423-43185445 CAGGCTTAGTATTTTCTTTCTGG - Intergenic
929825661 2:45307809-45307831 CAGGCTGAGGCTCTTCCTGCTGG - Intergenic
934950181 2:98570706-98570728 CAGGCGGAGGGTGCCCTTGCAGG + Intronic
935418644 2:102844306-102844328 CAGGCTGAGGATCTCTTTGCTGG + Intergenic
940160108 2:150702561-150702583 CAGGCTGAGGACTCTCCTATGGG + Intergenic
941461654 2:165779194-165779216 GTGGCTGAGGCTTCTCTTTCTGG - Intronic
942098538 2:172556121-172556143 CTGGCTGTGGCTTCTCTAGCGGG + Exonic
945147178 2:206750541-206750563 CAGGCTGGGCATTCTGTGGCAGG - Intronic
948405317 2:237713048-237713070 CAGGCTCAGGGTTTTCTTGAGGG + Intronic
1168974060 20:1951005-1951027 AAGGCGGCGGATTCTCCTGCAGG + Intergenic
1169798383 20:9490648-9490670 GAGGCTCAGGATTCACTTCCAGG + Intergenic
1169868646 20:10228025-10228047 CAGGCTTATGATTCTCTCCCAGG - Intronic
1169935619 20:10880445-10880467 CAGGCAGAGCCTACTCTTGCAGG + Intergenic
1171308252 20:24124388-24124410 TATGCTGAGGATTCTCTTCAGGG - Intergenic
1172292987 20:33789460-33789482 CAAGCTTAGGATCCTCTTGCTGG - Intronic
1173131393 20:40397510-40397532 TAGGCTCATGATTCTCTGGCTGG - Intergenic
1175613565 20:60372895-60372917 CAGACTGAGGTCTCCCTTGCTGG - Intergenic
1178053149 21:28769545-28769567 AAGGTTGTGGATTCTCTTGAGGG + Intergenic
1179099724 21:38346074-38346096 CAGGCTGAGGAAGTCCTTGCAGG + Intergenic
1180984978 22:19898781-19898803 CAGGCTGGGGCTGCTCTTGAGGG + Intronic
1181340079 22:22171774-22171796 CAGCCTCAGGATCCTCCTGCTGG - Intergenic
1181582598 22:23836506-23836528 CAGGCTCAGGGTTCTCATCCTGG - Intronic
1182852841 22:33490991-33491013 CAGGCTCAGGTTTGTCTGGCTGG - Intronic
1183110062 22:35642338-35642360 AAGGCTGAGGCTCCTCCTGCTGG + Intergenic
1183865681 22:40702365-40702387 CCTGCTGAGGATTCTCTTCCTGG - Intergenic
1185271804 22:49933272-49933294 CAAGCTGAGCAGTCTCTTGTGGG + Intergenic
1185398907 22:50605959-50605981 CAGGCTGAGGGTCCGCTTGGCGG + Intronic
949863045 3:8523879-8523901 CAGGCAGAGGATTTACTTTCAGG + Intronic
951494999 3:23316363-23316385 CAGGCAGAGGAGTCTCTCCCTGG + Intronic
951756822 3:26099907-26099929 CAGGCAAAGGATTCTATTCCTGG - Intergenic
951809359 3:26682618-26682640 CAGGCTGGGGATTGTCTTTCTGG - Intronic
952967827 3:38632057-38632079 CAGGCTGAGGAAGCTCATGGGGG - Intronic
953357766 3:42268802-42268824 CTGGCTGAAGATTGTCTTTCGGG - Intergenic
954279183 3:49563839-49563861 CAGGCAGATGATTCTACTGCTGG + Intronic
957512891 3:81212901-81212923 CAGCCTGATGATTCAATTGCAGG + Intergenic
959167839 3:102802753-102802775 CAGGATGAGGATTATCGTGGGGG + Intergenic
959833713 3:110893778-110893800 CAACCTGAGGACTCTCTTTCTGG - Intergenic
960933451 3:122878497-122878519 ATGGCTGAGGATTGTCTTGTTGG + Intronic
963260755 3:143188836-143188858 AAGGGTGAGTATTCTCTTCCAGG - Intergenic
965884903 3:173433249-173433271 CAGGATGAGGGTGCTCCTGCAGG - Intronic
966123847 3:176552314-176552336 AAGGCAGAGGTTTCTCTTCCTGG - Intergenic
967989731 3:195121901-195121923 CAGGCTGGGCTTTCTCTTGGAGG - Intronic
968801344 4:2745105-2745127 CTGCCTCAGGATTCTCTAGCGGG - Intronic
969308583 4:6339449-6339471 CTGGCTGAGGCTTCTCTGCCAGG - Intronic
971314311 4:25554469-25554491 CTGTGTGAGGATTCTCTGGCTGG + Intergenic
972559992 4:40218486-40218508 CAGGCTGAGGGCTTTTTTGCAGG + Intronic
978741924 4:112145999-112146021 CCGGCAGAGGATTCTCAGGCTGG + Intronic
980545226 4:134252808-134252830 CAGGCTGAGTGTTTCCTTGCAGG + Intergenic
980905684 4:138946554-138946576 TTGGCTGAGGACTCTCTTCCTGG - Intergenic
985589748 5:758344-758366 CAGGCTGAGGATGCCCTCCCAGG + Intronic
986972920 5:13357884-13357906 CAGTCTGAGAATTCTTGTGCTGG - Intergenic
990752974 5:59038804-59038826 CAGGCTGCTGATTCCCATGCCGG - Intronic
991530251 5:67606774-67606796 CAGGCTGAGGTTTCTCTGAAGGG + Intergenic
992380230 5:76229197-76229219 CAGGCTGAGGATCCTCACCCTGG + Intronic
993086272 5:83367531-83367553 CAGCCTGAGGAAGCTCTTTCAGG - Intergenic
994447161 5:99891006-99891028 CAGGGTGAGCATGCTGTTGCAGG - Intergenic
996053846 5:118963466-118963488 CAGGCTGAGGACTGACCTGCAGG + Intronic
999445100 5:151632866-151632888 GAGGCTGTGGATCCTCCTGCAGG + Intergenic
999491805 5:152058482-152058504 CAGGCTGAAGATACTGTAGCTGG + Intergenic
1001247135 5:170113206-170113228 CAGACTGATGGTTCTCTTGATGG - Intergenic
1002189132 5:177469787-177469809 CAGGCTGAGGACCCTCTGGGAGG + Intronic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006837312 6:37006844-37006866 CAGGCTGAGGCCTCTGTGGCAGG - Intronic
1008059791 6:46985063-46985085 CAGGCTGTGCATTCTTTTGAGGG + Intergenic
1011842297 6:91516777-91516799 CAGGCTGAGGACACTATTCCTGG + Intergenic
1012911713 6:105125395-105125417 CCGTCTGAGTATTCTCTTGAAGG - Exonic
1016570579 6:145507819-145507841 GAAGCTGAGGATTCTCCTGGAGG + Intronic
1017723226 6:157258824-157258846 CAGGCTGGGGACCCTCTGGCTGG + Intergenic
1018384584 6:163291161-163291183 CAGGCAGAGGGTCATCTTGCAGG - Intronic
1018384642 6:163291389-163291411 CAGGCAGAGGGTCATCTTGCAGG - Intronic
1019474471 7:1237233-1237255 AAGGCTGAGGATTCTCGTTGTGG - Exonic
1021243569 7:18234797-18234819 AAGGCCAAGGATTCTGTTGCAGG + Intronic
1021830277 7:24600029-24600051 CTGCCTGAGGATCTTCTTGCGGG + Intronic
1022469077 7:30670885-30670907 CAGGCAGGGTCTTCTCTTGCAGG + Intronic
1023913897 7:44574189-44574211 CCGGCCGAGGCTTCTCCTGCAGG - Intronic
1024117672 7:46208951-46208973 CAGGCTCAGAGTTCTCTTCCAGG + Intergenic
1024251669 7:47510105-47510127 GAGACTGAGGATTCACGTGCTGG + Intronic
1025023902 7:55500290-55500312 CAGACTGGAGATTCTCCTGCTGG + Intronic
1025082079 7:55992586-55992608 TTGGCTGAGCATTCTCTTCCTGG - Intronic
1026764802 7:73153958-73153980 CAGGCTGAGAACTCTTTTTCAGG - Intergenic
1027041275 7:74963728-74963750 CAGGCTGAGAACTCTCTTTCAGG - Intergenic
1027082365 7:75238648-75238670 CAGGCTGAGAACTCTCTTTCAGG + Intergenic
1029989726 7:104952233-104952255 CTGGGTGAGGAATCTCTTTCTGG + Intergenic
1030814528 7:114019029-114019051 CAGGCTGGGCAGTCTCTTACAGG - Intronic
1030982458 7:116202310-116202332 CAGCTTGAAGAGTCTCTTGCTGG - Intergenic
1033350683 7:140559451-140559473 CAGGCTAAGAATTATCTTCCGGG + Intronic
1035390067 7:158497758-158497780 CAGGCCAAGGTTTCTCCTGCAGG + Intronic
1035449121 7:158964010-158964032 CATGCTGAAGACTCGCTTGCTGG + Intergenic
1046489927 8:114938075-114938097 TTGGCTCAGGATTCTCTTCCAGG + Intergenic
1056854259 9:90111698-90111720 CAGGCTGAGGATTCTTTGTTTGG + Intergenic
1056921327 9:90791970-90791992 CAGGCTAAGGAGTCTGTTTCTGG + Intergenic
1057180654 9:93028140-93028162 CAGGCTGAGGTTTCTGGAGCTGG - Intronic
1059000273 9:110341504-110341526 CACTCTCAGGATTCTCTTCCTGG - Intergenic
1198934301 X:141889768-141889790 CAGGCTGTGGATTTTTTTCCTGG - Intronic
1200923860 Y:8637049-8637071 CAGGCAGTGGATTTTCTTGAGGG - Intergenic