ID: 928450388

View in Genome Browser
Species Human (GRCh38)
Location 2:31373125-31373147
Sequence GATTATCCACATTTGCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928450385_928450388 -1 Left 928450385 2:31373103-31373125 CCATCTTATGAAACAGGTATGTG 0: 1
1: 0
2: 3
3: 12
4: 198
Right 928450388 2:31373125-31373147 GATTATCCACATTTGCAGGTGGG 0: 1
1: 0
2: 2
3: 3
4: 138
928450383_928450388 7 Left 928450383 2:31373095-31373117 CCTCAAAACCATCTTATGAAACA 0: 1
1: 0
2: 4
3: 62
4: 484
Right 928450388 2:31373125-31373147 GATTATCCACATTTGCAGGTGGG 0: 1
1: 0
2: 2
3: 3
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928450388 Original CRISPR GATTATCCACATTTGCAGGT GGG Intronic
906079884 1:43078815-43078837 TATTATCCCTATTTGCAGATGGG - Intergenic
907141672 1:52191608-52191630 TATTATCCCCATTTGAAAGTAGG + Intronic
907607319 1:55830837-55830859 GATTTCCCAGATTTGGAGGTTGG - Intergenic
908000273 1:59672437-59672459 GATGATCCCCATTTGCATTTGGG + Intronic
910481359 1:87661964-87661986 AATTATGCCCATTTGCAGATGGG + Intergenic
913207062 1:116548919-116548941 TATTAACCCCATTTACAGGTAGG + Intronic
914866835 1:151437453-151437475 AATTATTCTCATTTGCTGGTGGG + Intronic
915269328 1:154742439-154742461 TATTATCCTCTTTTACAGGTGGG - Intronic
917779392 1:178376028-178376050 GAATATCAACATTTGGGGGTGGG + Intronic
920011937 1:202874250-202874272 GATGATCCACATCTGCTGGAAGG - Intergenic
921322391 1:213954573-213954595 GTTCATCCCCATTTACAGGTTGG + Intergenic
923641876 1:235771469-235771491 GAATATGCTCAGTTGCAGGTTGG - Intronic
924197671 1:241624914-241624936 TATTATCCCCATTTGCAGATGGG - Intronic
1067171033 10:43906091-43906113 GATTATCAAAACTTGCAGGCTGG - Intergenic
1068434466 10:56973028-56973050 TATAATCCCCATTTGGAGGTGGG - Intergenic
1072094529 10:92164175-92164197 CATTATACACATTTCCAGATGGG + Intronic
1075624810 10:123954715-123954737 GATTTTCCAGGTTTGCAGTTTGG + Intergenic
1079056281 11:17208780-17208802 AATTATCCCCATTTACAGATGGG + Intronic
1086057741 11:82667077-82667099 TATTATCCACATTGGCAGTCAGG - Intergenic
1093369464 12:18349802-18349824 GACCATGCACATTTGTAGGTAGG + Intronic
1094506600 12:31067078-31067100 AAATATCCACATTTGAAGATGGG - Intergenic
1100041981 12:90330892-90330914 GACTATGGACATTTTCAGGTGGG + Intergenic
1100048506 12:90413840-90413862 GGTTTTCCACATTTGTAGATGGG - Intergenic
1100210970 12:92398322-92398344 TATTATCCTCTTTTACAGGTGGG + Intergenic
1100213780 12:92426666-92426688 CATCAGCCAAATTTGCAGGTAGG + Intronic
1100546425 12:95607053-95607075 GTTTAACCAGAATTGCAGGTTGG - Intergenic
1101388115 12:104275742-104275764 GATTTTCCCCTTTTACAGGTTGG - Intronic
1106674716 13:31946164-31946186 GACCATCCATATTTCCAGGTAGG + Intergenic
1110143426 13:72159577-72159599 GATTGTCAAAATTTGCAGGGAGG + Intergenic
1111675496 13:91382802-91382824 GAATCTACACATGTGCAGGTTGG - Intergenic
1113320862 13:109230674-109230696 CCTTCACCACATTTGCAGGTTGG - Intergenic
1113722126 13:112566839-112566861 CATTTTCCACACTGGCAGGTGGG - Intronic
1114133832 14:19823977-19823999 GGTTCACCACATTTGCAGGGTGG - Intronic
1114833918 14:26180400-26180422 GCTTATGCCCATTTGCAAGTTGG + Intergenic
1114883460 14:26815989-26816011 GCTTATCCACATTTGTTAGTTGG + Intergenic
1115383205 14:32764049-32764071 GATTATCAACATTTCCAGCAAGG - Intronic
1116474767 14:45326647-45326669 GATTATATAAATTTGGAGGTAGG - Intergenic
1121196637 14:92078837-92078859 AATAATCCAAACTTGCAGGTGGG + Intronic
1122406883 14:101506009-101506031 GATTATCTCCTTTTACAGGTAGG + Intergenic
1123453433 15:20390272-20390294 GATTAGCCACATTTCTAGTTTGG + Intergenic
1124686633 15:31788601-31788623 AATCATCCATAGTTGCAGGTGGG + Intronic
1124854399 15:33372998-33373020 GATTATGCACCTTGGCAGGCAGG + Intronic
1125002950 15:34790466-34790488 GCTAATCCACATTTGCTGGAAGG + Exonic
1132389878 15:101430506-101430528 GTTTATCCACGTTTCCACGTGGG + Intronic
1133025255 16:2986444-2986466 GCTTATCCTCGTTTGCAGATGGG - Intergenic
1134242856 16:12518561-12518583 GAATATCTACGTTTGCAGGAGGG - Intronic
1137028138 16:35498752-35498774 GATTATCCCCCTTTTCAGTTGGG - Intergenic
1137465732 16:48707249-48707271 TATAATCCCCATTTGGAGGTAGG - Intergenic
1141160252 16:81625008-81625030 TCTTATCAACATTTGCAGATGGG + Intronic
1144105706 17:11983287-11983309 GATTACTCACCTATGCAGGTGGG + Exonic
1144805723 17:17965694-17965716 GATTATCTCCATTTTCAGATGGG - Intronic
1146506111 17:33407107-33407129 TATTATCTACTTTAGCAGGTGGG + Intronic
1148730827 17:49835335-49835357 GCTTATCCACATTGGCAGAATGG + Intergenic
1150953988 17:69835133-69835155 TATTATCCCATTTTGCAGGTGGG + Intergenic
1155319139 18:24601717-24601739 TATTTTCCACATTTCCAGGGAGG - Intergenic
1157439454 18:47699151-47699173 TATTATCCTCATCTGCAGATGGG - Intergenic
1162665532 19:12207790-12207812 AATAAGCCACATTTGAAGGTGGG - Intergenic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1165539225 19:36477471-36477493 GATTATACACATTTTAAGTTTGG + Intronic
1166049249 19:40248311-40248333 AATGCTCCACATTTGCAGGCCGG - Intronic
925563630 2:5225560-5225582 GATTCTGCACATTTACACGTTGG + Intergenic
928450388 2:31373125-31373147 GATTATCCACATTTGCAGGTGGG + Intronic
929033487 2:37670935-37670957 CAATATCCAGATCTGCAGGTTGG + Intronic
929438722 2:41948829-41948851 GATTTTGCACACTTACAGGTGGG - Intronic
935850811 2:107216876-107216898 GATTGTCTATATTTGCAGCTCGG - Intergenic
935979513 2:108613090-108613112 GATTATACCCATTTACAGATGGG - Intronic
939013705 2:136877043-136877065 GAATCTTCACATGTGCAGGTGGG + Intronic
939445367 2:142303387-142303409 GATTATTAACAGTTGCAGATTGG + Intergenic
940279240 2:151972432-151972454 GAAGGTCCACACTTGCAGGTGGG - Intronic
941414041 2:165196338-165196360 GAATATCCACATTTTGAGGCAGG - Intronic
941765831 2:169295281-169295303 GGTTATCCAAATGTGCAGATAGG - Intronic
943916511 2:193641704-193641726 GATTATCCACTGTTGAAAGTGGG + Intergenic
945267687 2:207907180-207907202 GATTAACCAGATTAGCAGCTAGG - Intronic
1169258048 20:4113664-4113686 GATTATCCTCCTCTGCAGGCTGG + Intergenic
1169309120 20:4520115-4520137 GATGCTCCACATTTGCAGGTGGG + Intergenic
1170335422 20:15265368-15265390 AAATTTCCACATTTGCTGGTGGG - Intronic
1170781358 20:19428482-19428504 GAAGTTCCACATTTGCATGTTGG + Intronic
1172126947 20:32630152-32630174 TATTATCTCCATTTTCAGGTCGG + Intergenic
1173163350 20:40668940-40668962 GATAATCCCCTTTTGCAGATGGG + Intergenic
1179455958 21:41500193-41500215 TATTATCTGCATTTGCAGATGGG - Intronic
1181531422 22:23519637-23519659 TATTATCCCCATTTGCAAGATGG + Intergenic
1183971767 22:41482769-41482791 CATTATCCCCATTTACAGATGGG + Intronic
950935387 3:16834247-16834269 TATTACCAACATTTACAGGTCGG + Intronic
952962549 3:38601811-38601833 GTTTATCCAGATTGGGAGGTAGG - Intronic
953717495 3:45328548-45328570 TATTATTCACGTTTACAGGTGGG + Intergenic
955735940 3:62038273-62038295 GATTTTCCAACTTTGAAGGTGGG - Intronic
955903009 3:63777274-63777296 GATTAACCACATGTCCAGTTGGG + Intergenic
956632441 3:71329641-71329663 CAATAAACACATTTGCAGGTGGG + Intronic
961727440 3:128941776-128941798 TATTATCTAAATTTGCAGGGTGG - Intronic
961882441 3:130071646-130071668 GCTTATCCACAGATGCAGGACGG + Intergenic
965287125 3:166830364-166830386 TATTATCCACACTTTGAGGTAGG + Intergenic
965644319 3:170864182-170864204 TAATATCCACATTGGCAGCTAGG - Intergenic
966249143 3:177842822-177842844 TATTATCCACATTTACAGAAGGG + Intergenic
966936630 3:184714340-184714362 TATTATCCACATTTACAAATGGG + Intergenic
976044249 4:80926589-80926611 GATAATCCACATTTCTAGCTTGG + Intronic
979228337 4:118317531-118317553 GACTATCCTCATTTGAAGGAGGG + Intronic
979573570 4:122259102-122259124 GATTATCAACATTTTCAATTTGG - Intronic
984137479 4:175958922-175958944 CATTTTTTACATTTGCAGGTAGG - Intronic
985174310 4:187185303-187185325 GATTATCCCCATTTTCAGCAGGG + Intergenic
987528712 5:19086707-19086729 TAATATCCAAATTTTCAGGTTGG + Intergenic
988175752 5:27722735-27722757 GATTAGCCAGCTTTCCAGGTAGG + Intergenic
994048028 5:95331054-95331076 GATTATCCTCATATTCAAGTGGG + Intergenic
995239038 5:109865018-109865040 CATTCTGCTCATTTGCAGGTGGG + Exonic
996115330 5:119611893-119611915 TATTATCCGCATTTCCAGGGAGG + Intronic
997730039 5:136163883-136163905 TATTATAAACATTTGCAGCTGGG + Intronic
999105882 5:149070576-149070598 GATTAGCCACAATTACAGGTGGG + Intergenic
1003442872 6:6159607-6159629 GATTGTGCCCATCTGCAGGTGGG - Intronic
1004315154 6:14580410-14580432 GATTAACCACAGTTCCAGGAAGG + Intergenic
1006270237 6:32959710-32959732 GATGACCCACATTTGTAGCTCGG - Intronic
1007329546 6:41094480-41094502 GATAGTCCCCATATGCAGGTAGG + Exonic
1008011521 6:46472642-46472664 GACAATCTGCATTTGCAGGTTGG - Intronic
1008878129 6:56351588-56351610 CATTATACACATGTGCAGCTTGG - Intronic
1009227056 6:61029648-61029670 TATTATGAACATTTCCAGGTGGG + Intergenic
1010380869 6:75223414-75223436 GATTTTCCACATTTGAATTTTGG + Intergenic
1010529774 6:76953702-76953724 GATTATCCACATGTGTTGATGGG - Intergenic
1010622526 6:78093809-78093831 AATTATCCAGATTTGAAGTTTGG + Intergenic
1011172826 6:84525019-84525041 GATAATCCACAATTGCCCGTTGG - Intergenic
1016739306 6:147510519-147510541 GATTATCCACATTTCCTATTAGG - Intronic
1019114441 6:169748061-169748083 GATTTTCCACTTTTTCTGGTGGG + Intronic
1019180246 6:170182338-170182360 GAGCATCCACACCTGCAGGTGGG + Intergenic
1019180273 6:170182557-170182579 GAGAATCCACACCTGCAGGTGGG + Intergenic
1022661909 7:32375488-32375510 GATTTTCCAAATTTACAGGGTGG + Intergenic
1022964793 7:35462513-35462535 GATTTACCAGAGTTGCAGGTTGG - Intergenic
1023308206 7:38853537-38853559 GAATCTCCACCTTTGCAGTTGGG - Intronic
1028817117 7:95158576-95158598 GTATATCCACATTTGTAAGTAGG - Intronic
1029032291 7:97481357-97481379 TCTTATCCACATTTGCAGGTGGG - Intergenic
1031033859 7:116765817-116765839 GATTATCCCCATTTATAGATAGG + Intronic
1046442432 8:114275547-114275569 GATTATCAACATTTACATTTAGG + Intergenic
1046776193 8:118166590-118166612 GGTTATTCACCTTTACAGGTTGG + Intergenic
1047753946 8:127904338-127904360 GGTTATCCAGTTTTGCAGGTTGG + Intergenic
1049974543 9:849104-849126 TATTATCCTCATTTACAGATAGG + Intronic
1050649422 9:7759211-7759233 GATTATCCGCATATGCCAGTAGG - Intergenic
1051134031 9:13897739-13897761 GCTTATCCAGTTTTGCAAGTTGG - Intergenic
1053431477 9:38044559-38044581 GATTCTCCTCAGTGGCAGGTGGG - Intronic
1056304406 9:85275047-85275069 GAGTATCCATCTTTGCAGTTTGG - Intergenic
1056998291 9:91484209-91484231 CATTATCCTCATTTTCAGTTGGG - Intergenic
1057529818 9:95834588-95834610 AATTGTCCACATTTGAAGGGAGG + Intergenic
1059093553 9:111388119-111388141 GCTTTTCCACTTTTGTAGGTAGG + Intronic
1059586446 9:115612589-115612611 TATTATCCCCATTTGCTGGATGG + Intergenic
1186530259 X:10287918-10287940 AATTATTCTCATTTGCAGATAGG - Intergenic
1187387474 X:18861681-18861703 GAGTGTCCACATGTGCAGGGTGG + Intergenic
1189066549 X:37815865-37815887 GATTATCCTGTTTTCCAGGTGGG + Intronic
1193453147 X:81695827-81695849 GATTTTCCAAATTTGAATGTTGG + Intergenic
1197851270 X:130862949-130862971 AATTATCTACATTTCCTGGTAGG + Intronic