ID: 928451365

View in Genome Browser
Species Human (GRCh38)
Location 2:31381357-31381379
Sequence GGCTCACCACAGCCTGCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 261}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928451365_928451375 20 Left 928451365 2:31381357-31381379 CCAACAGCAGGCTGTGGTGAGCC 0: 1
1: 0
2: 2
3: 16
4: 261
Right 928451375 2:31381400-31381422 CCCCACTAGGTAAGGCATGCAGG 0: 1
1: 0
2: 1
3: 7
4: 84
928451365_928451368 7 Left 928451365 2:31381357-31381379 CCAACAGCAGGCTGTGGTGAGCC 0: 1
1: 0
2: 2
3: 16
4: 261
Right 928451368 2:31381387-31381409 CCCAGCCCCAGTACCCCACTAGG 0: 1
1: 0
2: 1
3: 33
4: 304
928451365_928451371 12 Left 928451365 2:31381357-31381379 CCAACAGCAGGCTGTGGTGAGCC 0: 1
1: 0
2: 2
3: 16
4: 261
Right 928451371 2:31381392-31381414 CCCCAGTACCCCACTAGGTAAGG 0: 1
1: 0
2: 0
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928451365 Original CRISPR GGCTCACCACAGCCTGCTGT TGG (reversed) Intronic
900115820 1:1027470-1027492 GTCTCGCCTCAGCTTGCTGTTGG + Intronic
900531832 1:3157714-3157736 GGCCAAACACAGCCTCCTGTGGG - Intronic
901006155 1:6172568-6172590 GCTTCACCACTGCCAGCTGTAGG - Intronic
901615695 1:10537762-10537784 TGCTCAGCAAAGCCTGCGGTGGG - Intronic
902237198 1:15065101-15065123 GGCTCACCACAACCTCCTCCTGG + Intronic
902536616 1:17122545-17122567 GGCTGCCCACAGGCTGCTGTGGG + Intergenic
902569092 1:17335526-17335548 GGGTCACCATATCATGCTGTGGG + Intronic
903174615 1:21573552-21573574 GGCTCCCCACAGCCAGCTTGGGG - Intronic
903749397 1:25611390-25611412 GGCTCACCCCAGCAGGCTGTGGG - Intergenic
905855125 1:41305975-41305997 TGGTCACCACTTCCTGCTGTTGG - Intergenic
906609307 1:47190841-47190863 GGGCAAACACAGCCTGCTGTGGG + Intronic
906658698 1:47567218-47567240 GGCTGCACACAACCTGCTGTAGG + Intergenic
907188664 1:52631648-52631670 GGCTCACCCCAGAGGGCTGTTGG + Intergenic
907249819 1:53130585-53130607 GGAGCACCACAGCCTCCTGCTGG + Intronic
910646645 1:89522373-89522395 CGCACACCACGGCCTGTTGTGGG + Intergenic
913424871 1:118716952-118716974 GGCACACCACAAGCTCCTGTGGG - Intergenic
916603964 1:166322993-166323015 AGCTGACCACAGCTTTCTGTTGG + Intergenic
917745976 1:178007536-178007558 GGCTCACCATTGCCTGATGGTGG - Intergenic
920204855 1:204283979-204284001 GGCTCACCACTGCCTGGAGGAGG + Intronic
921752869 1:218817873-218817895 GGCACAGGACAGCCTGCTGCAGG + Intergenic
922542647 1:226430544-226430566 GGGTTACCACTGCCTGCTGAGGG - Intergenic
923095132 1:230769280-230769302 GTCTCCCCATAGCCTGCAGTTGG - Intronic
1064272050 10:13874172-13874194 GGCTCACCACAACCTGCGCCTGG - Intronic
1066002941 10:31121270-31121292 GGCTCACCCCAGACAGGTGTCGG - Intergenic
1067079909 10:43206981-43207003 GTCTCACCACACCCTGCAGCTGG + Intronic
1067848434 10:49740410-49740432 AGCCCAACACAGTCTGCTGTGGG - Intronic
1075990667 10:126836206-126836228 GGCACCCCAGAGCCTGCTGGTGG - Intergenic
1076336775 10:129712176-129712198 GGCTGACCCCAGGCTGCTGAGGG + Intronic
1076365895 10:129920951-129920973 GGCTCACAACAGCCTTCTGGTGG - Intronic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077190555 11:1254410-1254432 GGGTCACCCCGGCCTGCAGTCGG - Intronic
1077362191 11:2145670-2145692 GGGCCACTACACCCTGCTGTGGG - Intronic
1079804774 11:24916494-24916516 CACACACCACAGCCTGTTGTGGG - Intronic
1080956623 11:37104520-37104542 GGCTCACCACCTACTGGTGTTGG + Intergenic
1083386550 11:62315059-62315081 GGCTCCCAACACCCTGCTGCTGG - Intergenic
1083885606 11:65572194-65572216 GGGTCACCACAAACTCCTGTCGG - Intronic
1083908528 11:65690646-65690668 AGCTCACCAGTGCCTGCTCTAGG - Intergenic
1084638713 11:70411500-70411522 GGCTCGCCTCAGTCTGCAGTGGG - Intronic
1085467910 11:76736812-76736834 GGGTCTCCACAGCCTAGTGTCGG - Intergenic
1088476841 11:110249547-110249569 GGGTCACCACACCTTGCTGCTGG + Intronic
1090116292 11:123977622-123977644 GGCTCACCACAGTCTGGTTGGGG + Exonic
1091299574 11:134498811-134498833 AGCTCACCCCAGCCTGCAGATGG + Intergenic
1091722541 12:2823909-2823931 GGAGTACCACAGCCTGCTGCAGG + Exonic
1092191728 12:6526275-6526297 TGCTCTCCACAGCCTTCTCTGGG + Exonic
1092741113 12:11630508-11630530 GGCACACCCAAGCCAGCTGTTGG + Intergenic
1092826491 12:12404660-12404682 AGTTCTCCACAGACTGCTGTTGG - Intronic
1099005645 12:77232196-77232218 TGCTAACCACAGCCAGATGTTGG + Intergenic
1099661503 12:85568758-85568780 GGTTCACCACAGCCTTCCATGGG + Intergenic
1100779736 12:98011254-98011276 GGGTCTCCACCGCATGCTGTTGG + Intergenic
1101618203 12:106358326-106358348 GAGGCACCACAGCCGGCTGTGGG + Intronic
1103321374 12:120094561-120094583 GACTCACCACTGGCTGCTGCTGG + Intergenic
1103592788 12:122004209-122004231 GGATCACCCCTGCCTGTTGTGGG + Intergenic
1103947475 12:124534575-124534597 GGCTCATGACAGGCTGTTGTCGG - Intronic
1106629742 13:31458731-31458753 CACTCACCACGGCCTGTTGTGGG + Intergenic
1106948473 13:34855215-34855237 GCCTCCCCACAGCCTGCTCAAGG + Intergenic
1107013853 13:35693762-35693784 GTCTCCCCACAGCCTCCTGGGGG + Intergenic
1108773413 13:53733475-53733497 GTCTCATCACAGATTGCTGTAGG + Intergenic
1111320452 13:86621101-86621123 CACACACCACAGCCTGTTGTGGG + Intergenic
1112540000 13:100299785-100299807 GGCTCACTACAGCCTTCTCCTGG + Intronic
1113476037 13:110582038-110582060 GCCTCACCGCAGCCTGGTGAGGG + Intergenic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1116330954 14:43597142-43597164 GGCTCACACCAGCTTTCTGTTGG - Intergenic
1119478683 14:74946590-74946612 GGGTCACCAGAGCCTGGAGTGGG - Intronic
1119616680 14:76103358-76103380 GGCTCACGGCAGCCTGCCCTGGG + Intergenic
1121026584 14:90620684-90620706 GGCACCCCACTGCCCGCTGTGGG - Intronic
1121274175 14:92656637-92656659 GTGTCACCAGAGCCTGCCGTGGG + Intronic
1121603129 14:95220813-95220835 GCCCCACCACAGCCTGCAGAAGG - Intronic
1121721998 14:96115852-96115874 GGCTCACCGCAGCGTGATCTCGG + Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1123967658 15:25475112-25475134 CACTCACCACACACTGCTGTTGG + Intergenic
1125492168 15:40156452-40156474 GGCTGACTACTGCCAGCTGTGGG - Intergenic
1126636579 15:50786038-50786060 GGCTCACCACAACCTCCTCCTGG + Intergenic
1126780408 15:52134774-52134796 GTCTCACCACTGCCTCCTGACGG + Intronic
1128515860 15:68341565-68341587 GTTTCCCCAAAGCCTGCTGTGGG + Intronic
1133814747 16:9188106-9188128 CTCCCACCTCAGCCTGCTGTGGG - Intergenic
1134039084 16:11054081-11054103 GCCTCATCACATCCTCCTGTGGG - Intronic
1135226182 16:20660325-20660347 GGCTCAGCCCAGCCAGCTCTTGG + Intronic
1138815569 16:60199407-60199429 GGCCCCCCACCTCCTGCTGTTGG - Intergenic
1139528760 16:67531353-67531375 GGCTCACCACAGCGCTCTGGGGG - Intronic
1140988182 16:80179901-80179923 GGCTCTCCAGAGCCAGCTGTGGG - Intergenic
1141268600 16:82519350-82519372 TGCTCACCAATGCCTGCTTTGGG + Intergenic
1141687863 16:85580553-85580575 GGGACACCGCAGCCTCCTGTTGG + Intergenic
1142508284 17:379827-379849 GACTCCCCACAGCCAGCTGGGGG + Intronic
1142865904 17:2791335-2791357 CGCTTCCCAGAGCCTGCTGTGGG - Intronic
1144101246 17:11944188-11944210 GTCTCAGCACTGCCTGCTGGAGG + Intronic
1144727586 17:17509615-17509637 GTCTCGCCACAGCCCGCTCTGGG - Intronic
1145711595 17:26983366-26983388 GCCCCACCACTTCCTGCTGTGGG + Intergenic
1148103034 17:45104311-45104333 AGCCCAGCCCAGCCTGCTGTAGG + Intronic
1150489819 17:65566554-65566576 GGCTACCCACAGCCTGATCTGGG + Intronic
1151352374 17:73539420-73539442 GGCTCAGCACAGCCAGGAGTGGG + Intronic
1151852173 17:76697518-76697540 GGCTCAGCCCAGCCTGCCCTGGG - Intronic
1157576918 18:48749849-48749871 CCCTCACTACAGCCTGCTGGTGG - Intronic
1158702458 18:59760746-59760768 GGGTCACCACAGTCAGCTATTGG + Intergenic
1158720939 18:59923936-59923958 GGCTCATCACAGCTTCCTGGTGG - Intergenic
1160523773 18:79523851-79523873 AGCTCACCACATCCTGTTGCGGG + Intronic
1160903630 19:1441458-1441480 GGCCCACAACAGCCTCCTGTGGG + Intergenic
1161041806 19:2114443-2114465 TACTCAACACAGCCTGCTGGAGG + Intronic
1161080964 19:2309947-2309969 GGCCCCCCACAGGATGCTGTGGG + Intronic
1161357320 19:3826229-3826251 GGCTCAGGACAGCTTGCTGAGGG - Intronic
1161399805 19:4062227-4062249 GGCCGTCCACAGCCTGCTGGGGG + Intronic
1162098107 19:8322804-8322826 GGCTCACTACACCTAGCTGTGGG - Exonic
1163312820 19:16524173-16524195 GGCTCACTGCAGCCTCCTCTTGG - Intronic
1163403997 19:17111184-17111206 TCCTCACCACATCCTGATGTGGG + Intronic
1165128291 19:33616513-33616535 CGCTCCCCACAGCCTGAGGTGGG - Intergenic
1165142933 19:33713240-33713262 GCATCTCCACAGACTGCTGTGGG - Intronic
1166727781 19:45039178-45039200 GGCTCTCCCCATGCTGCTGTGGG + Intronic
925701831 2:6646530-6646552 GGCTGACCACAACATGCTCTGGG + Intergenic
927364714 2:22281036-22281058 TGCACACCAAAGCCTTCTGTAGG + Intergenic
928451365 2:31381357-31381379 GGCTCACCACAGCCTGCTGTTGG - Intronic
928949781 2:36804396-36804418 GGCTCACCCCAGGCTGCAGGGGG + Intronic
929442381 2:41974129-41974151 GGCTCACCACAGCTTACAGTGGG + Intergenic
929626724 2:43416520-43416542 GGCCTACTACAGCCTACTGTAGG + Intronic
931110738 2:59108581-59108603 GGTTCATCAGAGCATGCTGTGGG - Intergenic
932563477 2:72891601-72891623 GGCTCCCCACACCCTGCCATAGG + Exonic
933773745 2:85759398-85759420 GCCTTACCTGAGCCTGCTGTGGG + Intronic
936344187 2:111662829-111662851 GTCTCAGCACAGCCTGGAGTTGG - Intergenic
943888146 2:193249393-193249415 GTCTCACCACTGCCTGCTACTGG - Intergenic
944139503 2:196439708-196439730 GGCTCCCCACTCCCTACTGTTGG - Intronic
946210642 2:218144549-218144571 GACCCACCACACCCGGCTGTTGG + Intergenic
946277970 2:218644832-218644854 GGCTCAGCACAGCCTGCTTGTGG + Exonic
946359685 2:219211710-219211732 AGCTCACTACAGCCTCCTGGTGG + Intronic
948189094 2:236044628-236044650 AGCTCACCACAACCTACAGTAGG + Intronic
948407191 2:237731075-237731097 GGCTGAGCACAGGGTGCTGTTGG + Intronic
948730422 2:239959985-239960007 GGCACTCCACAGCCGCCTGTGGG - Exonic
1168966002 20:1898283-1898305 GGCTCAACACATCAGGCTGTTGG + Intronic
1169621821 20:7515542-7515564 GACTCTCCACAGCCTGCTGTGGG + Intergenic
1171213853 20:23337498-23337520 GGCACAGCAGAGCCTGCTGAAGG + Intergenic
1171493501 20:25538455-25538477 AGCTCACCCCAGCCTCCTCTGGG + Intronic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1172025435 20:31945287-31945309 GGCTCACCACAGCCATCTGTGGG - Exonic
1172806535 20:37615823-37615845 GGCCCACAACTGCCTGCTGCAGG - Intergenic
1173464747 20:43271907-43271929 TGCTCCCCAGAGCTTGCTGTTGG - Intergenic
1175150456 20:56929672-56929694 GACTCACCACAGCTTGCTGAAGG - Intergenic
1175232833 20:57484889-57484911 TGCTCACTGCAGCCTGCTCTGGG + Intergenic
1175319714 20:58076606-58076628 AGCTCACCCCACCCAGCTGTGGG - Intergenic
1175606669 20:60316957-60316979 GGGAAACCACAGCCTGCTGCGGG - Intergenic
1175912290 20:62410688-62410710 TGCTCACCACAGCCTGGAGAGGG - Exonic
1176307652 21:5132545-5132567 GGCACATCCCAGCCTTCTGTAGG + Intronic
1178584167 21:33859012-33859034 GGCACCCCAGAGCCTGCTGTTGG + Intronic
1178724093 21:35035972-35035994 GCCTCCCCAGAGGCTGCTGTGGG + Intronic
1178806422 21:35843408-35843430 GATGCACCACAGCCAGCTGTGGG + Intronic
1179548239 21:42126280-42126302 GGCCCCCCACGCCCTGCTGTGGG - Intronic
1179562082 21:42221854-42221876 GGCTCACCACGGCCTGTGGGTGG + Intronic
1179849408 21:44129485-44129507 GGCACATCCCAGCCTTCTGTAGG - Intronic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180627842 22:17206404-17206426 GGCTCACAGCAGCCTGATCTTGG - Intronic
1180852245 22:19027512-19027534 GGATCAGCACAGCCAGCTGCTGG + Intergenic
1180976501 22:19851622-19851644 GCCTCACCACAGGCAGCTGAGGG + Exonic
1181522320 22:23456794-23456816 GCCCCACCACATCCTGCAGTTGG + Intergenic
1181673129 22:24435199-24435221 GGCTCACCAGAGACTGCACTTGG - Intronic
1183018023 22:35006063-35006085 GGCTCTACCCAGCCTTCTGTGGG + Intergenic
1184252401 22:43268185-43268207 GGCTCACAGAAGCCTGCTCTGGG - Intronic
1184322708 22:43754646-43754668 TGCTCACCACAGCCTTATTTTGG + Intronic
1184650771 22:45918622-45918644 GCCTCACCACCGGCAGCTGTGGG + Intergenic
949754443 3:7392858-7392880 GTCTCACCACAGCCTGTTACAGG + Intronic
950038062 3:9901617-9901639 GCCTAACCACAGCCTGCTTTTGG - Intergenic
950452505 3:13073199-13073221 GGCCCTCCACAGCCCGCTGCTGG - Intergenic
951686154 3:25346870-25346892 TGCTCACCAGAGCCTCCTTTTGG - Intronic
953980345 3:47410312-47410334 TGCTCACCACGCCATGCTGTGGG - Exonic
958675706 3:97265710-97265732 GGTTCCCCACAGCCTGTGGTGGG + Intronic
961607867 3:128110725-128110747 CGCTCAGCTCCGCCTGCTGTGGG + Intronic
962969749 3:140388130-140388152 GACTCAACACAGCCTGTAGTGGG - Intronic
965000337 3:162944850-162944872 GCCTCACCACAGCCTTTTCTGGG - Intergenic
966184036 3:177212564-177212586 ACCTCACCACAGCCTGAAGTAGG + Intergenic
966658211 3:182383679-182383701 GCCCCACCACAGGCTGTTGTTGG + Intergenic
967100245 3:186210210-186210232 GCCTAACCACAGCCAGCTGCAGG - Intronic
968645157 4:1736968-1736990 GGCTCCGCTCAGCCTGCAGTGGG + Intronic
968893077 4:3382436-3382458 GGCTCAGCACAGCATCCAGTCGG - Intronic
968973071 4:3806178-3806200 GTCTCACCACTGGCTGCAGTGGG - Intergenic
969298262 4:6282038-6282060 AGCTCACCACGGCCTGCCCTGGG - Intronic
969492791 4:7509603-7509625 GGTTCACCCCAGCCCCCTGTGGG - Intronic
969576685 4:8040167-8040189 TGCCCACCCCTGCCTGCTGTGGG - Intronic
969591542 4:8124865-8124887 GCATCCCCACAGCCTGCTCTGGG + Intronic
969670131 4:8585618-8585640 TCCTCACCACAGCCTGGGGTAGG + Intronic
977507056 4:97915800-97915822 GGCTCACCATTGCCTGATGGTGG - Intronic
977507160 4:97916637-97916659 GGCTCTCCACAGCCTGGCATGGG - Intronic
977581328 4:98728484-98728506 GGATCAGCACAGAATGCTGTGGG + Intergenic
981511712 4:145565546-145565568 GGCTCCCCAGAGAGTGCTGTAGG + Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
986573625 5:9190518-9190540 GGGTGGCCACAGCCAGCTGTGGG - Intronic
991019172 5:61962249-61962271 TGCTGACCATAGCATGCTGTAGG - Intergenic
993624215 5:90204848-90204870 GGTACACAACTGCCTGCTGTGGG - Intergenic
997461047 5:134052768-134052790 AGCTCCCCACAGCATGGTGTCGG - Intergenic
1001435530 5:171696352-171696374 AGCCCACATCAGCCTGCTGTGGG + Intergenic
1001835964 5:174832739-174832761 GGCTCTCCACAAGCTCCTGTTGG + Intergenic
1002347374 5:178557433-178557455 GGCTCACCAGAGCCAGCTCAGGG + Intronic
1002928259 6:1617522-1617544 GGGGCCCCACAGCCTTCTGTGGG - Intergenic
1003349942 6:5306846-5306868 TGCCCACCTCAGCATGCTGTAGG - Intronic
1003479540 6:6518552-6518574 GGCTCACCACATCATGGTGAGGG + Intergenic
1004144228 6:13049827-13049849 GGCTCCCCACAGCATACAGTAGG - Intronic
1004175445 6:13335803-13335825 GGCTCATCCCAGCATGCTTTGGG + Intergenic
1004769627 6:18767441-18767463 GGCTAACAGCAGCCTGCTGTTGG + Intergenic
1006309113 6:33244846-33244868 GGCTCACCACAACCTCCTCTGGG + Intergenic
1006499527 6:34449010-34449032 GGCTCCCTGCAGCCTGCGGTGGG + Intergenic
1007508931 6:42360684-42360706 GCCTCCCCACAGCCTGGTGCAGG + Intronic
1007755520 6:44096738-44096760 GGCCAGGCACAGCCTGCTGTAGG - Intergenic
1012839812 6:104315969-104315991 GTCTCCCCACAGCTTGCTTTGGG + Intergenic
1013289270 6:108706805-108706827 GGCTGCCCACTGCCTGCTGCAGG + Intergenic
1013917806 6:115363307-115363329 TGCCCACCACAGCCAGCTTTAGG + Intergenic
1014213494 6:118730987-118731009 GTCCCACCACAGCCTGGTCTTGG + Intergenic
1014873482 6:126626594-126626616 GGCTTACCAAAGCCAACTGTGGG - Intergenic
1015006348 6:128286107-128286129 GGATCACCACTGGCTGCTGTGGG - Intronic
1016933029 6:149428024-149428046 GGGTCACTGCAGCCTGGTGTTGG + Intergenic
1017919332 6:158857618-158857640 GGCTGACCAAAGTGTGCTGTGGG + Intergenic
1018816598 6:167337117-167337139 TGCTGACCACAGCCAGCGGTTGG - Intronic
1019308989 7:349835-349857 TGCTGACCACAGCCTGCAGAGGG - Intergenic
1019589014 7:1819796-1819818 GCCCCACCACATCCTGCGGTTGG - Intronic
1019925662 7:4190639-4190661 GCCTGTGCACAGCCTGCTGTGGG - Intronic
1020151232 7:5683447-5683469 TGCTCACCACATCCTGAGGTGGG + Intronic
1022466187 7:30654602-30654624 GACTCCCCAGAGCCTGCTCTTGG + Intronic
1023113847 7:36841193-36841215 GCCTCAGCGGAGCCTGCTGTGGG - Intergenic
1025739740 7:64184627-64184649 GGCAGACCCCAGCCTGCTGATGG - Intronic
1025744786 7:64233164-64233186 GGCTCACCACAACCTCCTCCCGG - Intronic
1031417469 7:121510497-121510519 GGCTCAACACCCCCTGCTGGAGG + Intergenic
1033312072 7:140268657-140268679 GGCTCACCACAACCTCCTCCTGG - Intergenic
1034098755 7:148433934-148433956 GGCTGTCCACAGCCTTCTGCTGG + Intergenic
1034521784 7:151625982-151626004 GACTCAGCACAGCTGGCTGTGGG + Intronic
1035033491 7:155880126-155880148 GGCTCACCACAGACATCTGATGG + Intergenic
1035079148 7:156201884-156201906 TGCACACCACTGCCTGCTGCAGG + Intergenic
1035368642 7:158364297-158364319 GGCTCTGCAGACCCTGCTGTGGG - Intronic
1035368668 7:158364411-158364433 GGCTCTGCATACCCTGCTGTGGG - Intronic
1037691635 8:21185967-21185989 GGCCAACTCCAGCCTGCTGTGGG + Intergenic
1037808198 8:22069952-22069974 GGCTCACCAGAGCCTGCTTCCGG + Intronic
1037906802 8:22720268-22720290 GGCTTCCCCCAACCTGCTGTTGG - Intronic
1039395170 8:37219654-37219676 GGCACAGGCCAGCCTGCTGTTGG - Intergenic
1039594996 8:38784042-38784064 GGGTGGCCACAGCCTCCTGTTGG + Intronic
1046160356 8:110354970-110354992 GGCTGACCACAGCCTCAAGTTGG + Intergenic
1047508825 8:125500605-125500627 GGCTCACCAAAGCTGGCTGGGGG - Intergenic
1049217601 8:141415258-141415280 GTCTCCCCACTGCCTGCTGCAGG - Intronic
1049766346 8:144356983-144357005 GGCTCACCATGGAGTGCTGTAGG + Exonic
1051911238 9:22155113-22155135 GGCAGACCCCAGCCTGCTGACGG - Intergenic
1052098360 9:24411918-24411940 GCCTCATCACAGCCTGTTATTGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1056369681 9:85941418-85941440 GGCTCCCCAGTGCCCGCTGTCGG + Intronic
1056881331 9:90396406-90396428 GGCTCACCACAACCTCCTCCTGG - Intergenic
1057251790 9:93509054-93509076 TTCTCACCAGAGCCTGCAGTGGG - Intronic
1057696302 9:97325105-97325127 GGCACACCAGAGCGAGCTGTTGG + Exonic
1057884512 9:98819779-98819801 GGCCCACCTGAGCCTCCTGTTGG + Intronic
1058331178 9:103762619-103762641 GGTTCACCGCAGCCTTATGTTGG - Intergenic
1059592547 9:115677792-115677814 GGCTCTCCTCAGCCTGCAGAAGG - Intergenic
1060797119 9:126520196-126520218 GCCCATCCACAGCCTGCTGTGGG + Intergenic
1061510508 9:131058188-131058210 GGCTCACTGCAGCCTCCTGCTGG + Intronic
1061845890 9:133387889-133387911 GGCTCACAACAGCAGGCTGAGGG - Intronic
1062110256 9:134778367-134778389 GGCTCAGAACAGCCTGCTGCAGG - Intronic
1062410551 9:136422044-136422066 GGCCCACCACGGCCTGCGGGAGG - Intronic
1062545719 9:137063042-137063064 GGCAGACCCCAGCCTGCTGACGG + Exonic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1189744563 X:44156958-44156980 GGCTCACCATGGGCTGCTGATGG + Intronic
1190254494 X:48752439-48752461 CTCTCATCACAGACTGCTGTGGG + Intergenic
1192325503 X:70128528-70128550 GGCTCCCCACAACCTGCAGGCGG + Intergenic
1195980781 X:110576397-110576419 GGCTCACCCAAGCCTGCTTTTGG + Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic