ID: 928456724

View in Genome Browser
Species Human (GRCh38)
Location 2:31429046-31429068
Sequence TAGTGGGAAATGAGGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928456724_928456730 2 Left 928456724 2:31429046-31429068 CCTTCCAGCCTCATTTCCCACTA No data
Right 928456730 2:31429071-31429093 TCACCCACACAAACCATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928456724 Original CRISPR TAGTGGGAAATGAGGCTGGA AGG (reversed) Intergenic
No off target data available for this crispr