ID: 928458236

View in Genome Browser
Species Human (GRCh38)
Location 2:31444373-31444395
Sequence TTGCCTGTCTTTAGGATATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928458236_928458241 9 Left 928458236 2:31444373-31444395 CCTGATATCCTAAAGACAGGCAA No data
Right 928458241 2:31444405-31444427 CTGGTAAGGAGTGAAGAAAAGGG No data
928458236_928458240 8 Left 928458236 2:31444373-31444395 CCTGATATCCTAAAGACAGGCAA No data
Right 928458240 2:31444404-31444426 TCTGGTAAGGAGTGAAGAAAAGG No data
928458236_928458238 -10 Left 928458236 2:31444373-31444395 CCTGATATCCTAAAGACAGGCAA No data
Right 928458238 2:31444386-31444408 AGACAGGCAATAACAAATTCTGG 0: 21
1: 494
2: 934
3: 1038
4: 1523
928458236_928458239 -5 Left 928458236 2:31444373-31444395 CCTGATATCCTAAAGACAGGCAA No data
Right 928458239 2:31444391-31444413 GGCAATAACAAATTCTGGTAAGG No data
928458236_928458242 28 Left 928458236 2:31444373-31444395 CCTGATATCCTAAAGACAGGCAA No data
Right 928458242 2:31444424-31444446 AGGGACCTCTTGTACACTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928458236 Original CRISPR TTGCCTGTCTTTAGGATATC AGG (reversed) Intergenic
No off target data available for this crispr