ID: 928460956

View in Genome Browser
Species Human (GRCh38)
Location 2:31472127-31472149
Sequence GGCCTGAGTAGAGCAAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928460956_928460963 14 Left 928460956 2:31472127-31472149 CCACCTTTTGCTCTACTCAGGCC No data
Right 928460963 2:31472164-31472186 TAAGGCCACCTACACTGGGCAGG No data
928460956_928460961 9 Left 928460956 2:31472127-31472149 CCACCTTTTGCTCTACTCAGGCC No data
Right 928460961 2:31472159-31472181 TTGCATAAGGCCACCTACACTGG No data
928460956_928460959 -4 Left 928460956 2:31472127-31472149 CCACCTTTTGCTCTACTCAGGCC No data
Right 928460959 2:31472146-31472168 GGCCTTCAGTGGATTGCATAAGG No data
928460956_928460962 10 Left 928460956 2:31472127-31472149 CCACCTTTTGCTCTACTCAGGCC No data
Right 928460962 2:31472160-31472182 TGCATAAGGCCACCTACACTGGG No data
928460956_928460964 15 Left 928460956 2:31472127-31472149 CCACCTTTTGCTCTACTCAGGCC No data
Right 928460964 2:31472165-31472187 AAGGCCACCTACACTGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928460956 Original CRISPR GGCCTGAGTAGAGCAAAAGG TGG (reversed) Intergenic
No off target data available for this crispr