ID: 928462405

View in Genome Browser
Species Human (GRCh38)
Location 2:31486533-31486555
Sequence GTACCTGGATATTTTAGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928462401_928462405 -2 Left 928462401 2:31486512-31486534 CCTTGATTAGTTCCAATGCCTGT No data
Right 928462405 2:31486533-31486555 GTACCTGGATATTTTAGTTGAGG No data
928462399_928462405 22 Left 928462399 2:31486488-31486510 CCTTCTCCTTGGGTGAACTTGTT No data
Right 928462405 2:31486533-31486555 GTACCTGGATATTTTAGTTGAGG No data
928462400_928462405 16 Left 928462400 2:31486494-31486516 CCTTGGGTGAACTTGTTTCCTTG No data
Right 928462405 2:31486533-31486555 GTACCTGGATATTTTAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928462405 Original CRISPR GTACCTGGATATTTTAGTTG AGG Intergenic
No off target data available for this crispr