ID: 928466789

View in Genome Browser
Species Human (GRCh38)
Location 2:31529673-31529695
Sequence GAGTGGCCTCAACTGCTTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928466785_928466789 10 Left 928466785 2:31529640-31529662 CCTGTTGCCTGGAGAACATTCTG 0: 1
1: 0
2: 1
3: 13
4: 156
Right 928466789 2:31529673-31529695 GAGTGGCCTCAACTGCTTAACGG 0: 1
1: 0
2: 1
3: 8
4: 97
928466787_928466789 3 Left 928466787 2:31529647-31529669 CCTGGAGAACATTCTGGAGTTGC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 928466789 2:31529673-31529695 GAGTGGCCTCAACTGCTTAACGG 0: 1
1: 0
2: 1
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928466789 Original CRISPR GAGTGGCCTCAACTGCTTAA CGG Intronic
900948690 1:5845445-5845467 AAGTGGCCTCAACTGCCTCAAGG - Intergenic
901026565 1:6281567-6281589 GAGTGGCAGCACCTGCTGAAAGG + Intronic
901378199 1:8854781-8854803 GAGGGACCTCAGCTGCCTAACGG + Intergenic
901936099 1:12628158-12628180 GAGTGGCCTCACCTGCAAAAAGG + Intergenic
902134652 1:14294490-14294512 CAGTGGCCTCATCTGTTAAATGG - Intergenic
904095939 1:27977437-27977459 GAGTATCCTCATCTGCTAAATGG - Intronic
907952006 1:59192519-59192541 TAGTTTCCTCAACTGCATAATGG - Intergenic
909994218 1:82259149-82259171 CAGTTTCCTCAACTGCTTAAGGG + Intergenic
915314433 1:155020020-155020042 GAGTGGGCTCAGCTGCTCAGGGG + Intronic
916732293 1:167577103-167577125 GAATGGGCACAACCGCTTAATGG - Intergenic
918134363 1:181658585-181658607 AGGTGGCATCACCTGCTTAACGG + Intronic
919483561 1:198119245-198119267 GCGTGGCCTCAACAGATAAATGG - Intergenic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1068977697 10:63028605-63028627 GAGTGGGCTAAACTGCTATAGGG - Intergenic
1075493083 10:122891629-122891651 GAGCTGCCTCAACTTCATAAAGG + Intergenic
1078175463 11:8966240-8966262 GATGGGCCTCATCTGTTTAATGG + Intergenic
1079985266 11:27193133-27193155 GCCTGGCCTGAACTGTTTAAAGG + Intergenic
1082080038 11:48005856-48005878 GAGTGCCCTCATCTGCAAAAAGG - Intronic
1084364179 11:68686728-68686750 GAGTGGCCTGACCTGCCTGAGGG + Intronic
1084666254 11:70577893-70577915 CAGTGTCCTCATCTCCTTAAAGG - Intronic
1085183006 11:74551841-74551863 GAAGGGACTCAACTGCTGAAAGG + Intronic
1091450295 12:568701-568723 GAGTGTCCTCAACTTCTGGACGG + Intronic
1094554313 12:31483186-31483208 GAGTGAGCTCCACTTCTTAATGG - Intronic
1095841819 12:46701822-46701844 GAGTCTCCTCAACTCCATAAAGG - Intergenic
1098880135 12:75908902-75908924 GACTGTCTTCAATTGCTTAAGGG - Intergenic
1098922349 12:76314146-76314168 AAGTGGCCTCAATTGCTCCAGGG + Intergenic
1119668027 14:76498745-76498767 CAGTGGCCTCCACTCCTGAAGGG - Intronic
1119761433 14:77154799-77154821 GAGGGGCCTCAGCTCCTGAAAGG - Intronic
1121311589 14:92938315-92938337 CACTGGCCACAACTGCTGAATGG - Exonic
1122087420 14:99317410-99317432 CAGTGTCCTCAACTGCCAAATGG - Intergenic
1122193171 14:100064448-100064470 GGGTGGCCTCAACTGTAAAATGG - Intronic
1122274105 14:100582463-100582485 CAGTGTCCTCAACTGCAAAAGGG - Intronic
1122349794 14:101082418-101082440 GAGTGGCGGCAGCTGCTTTACGG - Intergenic
1122644006 14:103179552-103179574 GAGTGGCAGCAGCTGCTTTATGG - Intergenic
1122849893 14:104522505-104522527 GAGAGGCCTGAACTGCTCTAAGG - Intronic
1124128691 15:26965330-26965352 TAGTGGCCTCATCTCCTTCAGGG + Intergenic
1124864517 15:33475736-33475758 GAGTTTTCTCATCTGCTTAATGG + Intronic
1128162272 15:65431435-65431457 GCCTGGCCTCTACTTCTTAAAGG - Intergenic
1132362932 15:101233045-101233067 CAGTGGCCTCATCAGCTGAAGGG - Intronic
1132387167 15:101408764-101408786 CACAGGCCTAAACTGCTTAATGG + Intronic
1134655879 16:15948320-15948342 TAGTGGCCTCATCTGCAAAATGG + Intergenic
1135188876 16:20338216-20338238 AAGTGGACTCAACTCCTGAAAGG + Intronic
1136286873 16:29249336-29249358 GAGTGGCCTCATCTGGAAAAAGG - Intergenic
1137699682 16:50488594-50488616 GGCTGGAGTCAACTGCTTAAAGG + Intergenic
1139515274 16:67449077-67449099 CAGTGGCCTCAAATGCCTAATGG - Intronic
1140813150 16:78597474-78597496 GGGCGGCCACAAATGCTTAATGG - Intronic
1142092473 16:88221971-88221993 GAGTGGCCTCATCTGGAAAAAGG - Intergenic
1147402402 17:40188889-40188911 GAGTGGCTTCACCTGCTTGCTGG - Exonic
1152873681 17:82773370-82773392 GAGGGGCCTCACCTGCTCCAGGG - Intronic
1158755896 18:60324939-60324961 AAGTTGCTTCAACTTCTTAAAGG + Intergenic
928174035 2:29022230-29022252 GAAAGGCCTCAACTCCTTACAGG - Exonic
928466789 2:31529673-31529695 GAGTGGCCTCAACTGCTTAACGG + Intronic
932437971 2:71714190-71714212 GCGAGGCCTCAGCTGCTGAAAGG + Intergenic
944385655 2:199161193-199161215 GGGTGTCATCAACTGCTGAAGGG - Intergenic
944638366 2:201696609-201696631 GTGTGCCCCCAACTGCTGAATGG - Intronic
1169694307 20:8370023-8370045 GAGTGGCTGTAACTTCTTAAAGG - Intronic
1169714849 20:8603828-8603850 GGGTGATTTCAACTGCTTAATGG + Intronic
1175092732 20:56518395-56518417 GAGTGGCCACACCAGCTTGAAGG - Exonic
1175952423 20:62590625-62590647 GAGTGGCCGCCTCTGCTTGATGG + Intergenic
1178375868 21:32067170-32067192 GAGTGGCTGCAACTGCTAGAAGG - Intergenic
1182957445 22:34439914-34439936 CATTGGCCTCAAATGTTTAATGG + Intergenic
1185332052 22:50256320-50256342 GCGTGGCCTCAAGTCCTTGAAGG - Intronic
952127033 3:30313188-30313210 CAGTGCCCTCAAGTGGTTAAAGG - Intergenic
953958144 3:47247082-47247104 CAGTGGCCTCACCTGCCTAGTGG - Intronic
954654729 3:52186973-52186995 GAGTGGCCTCAGATCCTTGATGG - Intergenic
955703955 3:61709137-61709159 CAGTGGCCTCATCTGCAAAATGG - Intronic
964689162 3:159430805-159430827 GAGTGGACTGATCTGCTCAAGGG + Intronic
972830516 4:42809525-42809547 GAGTGGTCACAACTGCTTGCAGG - Intergenic
974529586 4:63090448-63090470 AAATGGGCACAACTGCTTAATGG - Intergenic
976871096 4:89794737-89794759 AAGTAGCCGCTACTGCTTAAAGG + Intronic
980485895 4:133457285-133457307 AAATGGCTTCAAGTGCTTAATGG + Intergenic
984478344 4:180265775-180265797 GTTTGGACTCAACAGCTTAATGG + Intergenic
989119825 5:37993272-37993294 GAGTGGCCTCCACTTCTTATTGG + Intergenic
993658702 5:90603571-90603593 GAGTTTCCTCAATTGCTAAAGGG - Intronic
996568822 5:124910299-124910321 GAGTGGCCTGGACTGCTGATTGG + Intergenic
997286316 5:132681290-132681312 GAGTGTCCTCAACGGCTTCCTGG - Intronic
998366542 5:141636367-141636389 GGGTGGCGTCCTCTGCTTAATGG - Intronic
998575048 5:143306161-143306183 GAGTGGCCTTCACTGCTTAAAGG - Intronic
1018986624 6:168642859-168642881 GACAGGCGTCAAATGCTTAATGG + Intronic
1021228791 7:18060608-18060630 GAGTGTTCTTAAATGCTTAAAGG + Intergenic
1022865024 7:34408732-34408754 GAGTGGCCTCTGCTGCTTTCAGG + Intergenic
1023779345 7:43641781-43641803 GAGTGTGATCAACTGCTTACGGG - Intronic
1024602378 7:50995158-50995180 AAGTGGCCTCTATTGCTAAAAGG - Intergenic
1025727616 7:64081645-64081667 GTCTGGCCACAACTGCTTACAGG - Intronic
1029805221 7:102988975-102988997 GAGTGGTCTCACCTTCTGAAGGG - Intronic
1030564525 7:111136539-111136561 GAGTGACCTGAATTGCTTTAAGG - Intronic
1035554025 8:551581-551603 GAGTTGTCTCCACTGCTTTATGG - Intergenic
1038328166 8:26588027-26588049 CAGTGGCCTCATCTGCAAAATGG + Intronic
1039264465 8:35809286-35809308 GAGTGGCCACACCTGCTTGCAGG + Intergenic
1039681883 8:39748304-39748326 GAGTGGTCTCCACTGCTCATTGG + Intronic
1041122262 8:54599221-54599243 GAGTGGGCTCAACAGCATCATGG - Intergenic
1044308102 8:90660738-90660760 GAAATGCCTCAACTGCTGAAAGG + Intronic
1045613312 8:103874335-103874357 AACTGGCCTCAACTGCTTCAGGG - Intronic
1045720777 8:105108328-105108350 CAGTGGCCTCACCTGCAAAATGG - Intronic
1048140488 8:131789579-131789601 GTGAGGCCTCAACAGCTTAAGGG + Intergenic
1048771890 8:137903969-137903991 GACTGGCCACAACTGCTCCATGG + Intergenic
1054782402 9:69177083-69177105 CTGTAGCCACAACTGCTTAATGG - Intronic
1057430738 9:94991311-94991333 GTGTGGCCTCTGCTGCTTCATGG + Intronic
1057768456 9:97944480-97944502 GAGGGGCCTCAACTTCTCATTGG + Intronic
1058673804 9:107383140-107383162 CAGTGGCCTCATCTGCAGAATGG + Intergenic
1062004261 9:134231470-134231492 CAGTGGCCCCAGCTTCTTAAAGG + Intergenic
1187692014 X:21878514-21878536 GAGTTGCTTCAACTGCTTTCCGG - Exonic
1192050423 X:67719313-67719335 GAGTTGATTCAACTGCTTAAGGG - Intronic
1196194052 X:112822014-112822036 GCATGGCCTCAACTGCCTAGTGG - Intronic
1199938442 X:152600597-152600619 GAGGGGCCTGGACTGCTGAATGG - Intergenic
1200035106 X:153321598-153321620 GAGTGGGCTCCACAGCTTGAAGG - Intergenic
1200901278 Y:8434608-8434630 GAGTCTCATCAACTTCTTAAGGG - Intergenic