ID: 928467270

View in Genome Browser
Species Human (GRCh38)
Location 2:31533680-31533702
Sequence ACTGCCTTCTGCACTGGAAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928467270_928467273 1 Left 928467270 2:31533680-31533702 CCATTTCCAGTGCAGAAGGCAGT 0: 1
1: 0
2: 2
3: 19
4: 216
Right 928467273 2:31533704-31533726 CCTCTGAGAATGAGTATAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 116
928467270_928467274 7 Left 928467270 2:31533680-31533702 CCATTTCCAGTGCAGAAGGCAGT 0: 1
1: 0
2: 2
3: 19
4: 216
Right 928467274 2:31533710-31533732 AGAATGAGTATAGCTGGATAAGG 0: 1
1: 0
2: 0
3: 11
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928467270 Original CRISPR ACTGCCTTCTGCACTGGAAA TGG (reversed) Exonic