ID: 928467270

View in Genome Browser
Species Human (GRCh38)
Location 2:31533680-31533702
Sequence ACTGCCTTCTGCACTGGAAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928467270_928467274 7 Left 928467270 2:31533680-31533702 CCATTTCCAGTGCAGAAGGCAGT 0: 1
1: 0
2: 2
3: 19
4: 216
Right 928467274 2:31533710-31533732 AGAATGAGTATAGCTGGATAAGG 0: 1
1: 0
2: 0
3: 11
4: 172
928467270_928467273 1 Left 928467270 2:31533680-31533702 CCATTTCCAGTGCAGAAGGCAGT 0: 1
1: 0
2: 2
3: 19
4: 216
Right 928467273 2:31533704-31533726 CCTCTGAGAATGAGTATAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928467270 Original CRISPR ACTGCCTTCTGCACTGGAAA TGG (reversed) Exonic
900837902 1:5020209-5020231 ACTCCCCTCTGAGCTGGAAAAGG + Intergenic
900986966 1:6078721-6078743 CCTGGCTGCTGCACTGGGAATGG + Intronic
901357793 1:8666571-8666593 AATGGCTTTTGCTCTGGAAAGGG + Intronic
903127457 1:21257648-21257670 ACGGCCTCCTGCCCTGGGAATGG + Intronic
903557507 1:24204337-24204359 ACAGCCTTCTGCACTGGGGAGGG + Intergenic
904807811 1:33144017-33144039 ACTATCTTCTGTACAGGAAAAGG - Intergenic
906621204 1:47281116-47281138 TCTGCCTACTCCATTGGAAATGG - Exonic
907237380 1:53061867-53061889 CCAGCCTTCCGCACTGGAACTGG - Intergenic
907655682 1:56340041-56340063 ACTGCCTCCTCCACTGGGATAGG + Intergenic
911496945 1:98643491-98643513 TTTGCCTTCTCCTCTGGAAAAGG + Intergenic
911678856 1:100691428-100691450 ACTGCCACCTCCACTGGAACAGG - Intergenic
919277951 1:195445262-195445284 ACTGCCACCTCCACTGGAACAGG + Intergenic
921123133 1:212153874-212153896 CTTTCCTTCTGCACTGAAAAGGG - Intergenic
921265019 1:213414991-213415013 ACTGGCTTCTTCACTGGAAAAGG + Intergenic
922922007 1:229313404-229313426 ACTGCCTGCTGGTCTGGAATGGG - Intergenic
922945131 1:229507914-229507936 ACTACCTGCAGCAGTGGAAAAGG + Intronic
924815975 1:247442549-247442571 TCTTCCTTCTGCACAGCAAAAGG - Intronic
1064561921 10:16601883-16601905 TCTGCCATCGGAACTGGAAAAGG + Intronic
1067184677 10:44016421-44016443 GCTGCTTCCTGCATTGGAAAGGG + Intergenic
1067686944 10:48471342-48471364 ACTGCCTTCTGCGCTGCCACTGG + Intronic
1070050085 10:72880191-72880213 CTTGCCTTCTGCACTGGCTAGGG - Intronic
1070806105 10:79271650-79271672 GCTGCCTGCTTCACTGGATATGG - Intronic
1072928031 10:99633906-99633928 CCTGCCACCTGCACTGGAACAGG + Intergenic
1073381332 10:103080106-103080128 ACTCCCTTCCACACTTGAAAAGG - Exonic
1073934464 10:108614512-108614534 ACTGCCCTCTGCTCTGGAAGAGG + Intergenic
1074062298 10:109977912-109977934 ATTGAATTGTGCACTGGAAAAGG - Intergenic
1074101133 10:110355669-110355691 TATGCCTTCAGCACTGGACAGGG - Intergenic
1074713989 10:116201629-116201651 GCTTCCTCCTGCACTGGAAGAGG + Intronic
1075968985 10:126637296-126637318 TCTGCCTTCTGCCTTGGAGATGG + Intronic
1081258626 11:40930125-40930147 ACTACCTTCTGGACTAGAAGTGG - Intronic
1081558644 11:44191543-44191565 ACTGGCTTCTGCCAGGGAAAAGG - Intronic
1082911094 11:58375451-58375473 ACAGCCATCTGCACTGGCAATGG - Intergenic
1083333405 11:61909515-61909537 CCTGCCCTCTGCTCTGGAACCGG + Intronic
1083630675 11:64093646-64093668 ACTGCCCTCTTCCCTGGACAGGG + Intronic
1084112022 11:67020397-67020419 GCTGCATGCTGCACTGGAAATGG - Intronic
1085238793 11:75034778-75034800 ACTGGCTTCTGCATGGGGAAGGG + Intergenic
1085659939 11:78354733-78354755 AATGGCTTCAGCACAGGAAAAGG - Intronic
1086300623 11:85423315-85423337 CCTGCCACCTCCACTGGAAAAGG - Intronic
1089605998 11:119641651-119641673 CCTGCCTCCTCCACTGGAATGGG + Intronic
1089743258 11:120599639-120599661 AGTACTTTCTGCACTGAAAACGG - Intronic
1090113179 11:123938542-123938564 ACTGCCCCCTGCACTTTAAAAGG - Intergenic
1090591280 11:128272673-128272695 ACTGGCTTCAGTACTGGCAAAGG + Intergenic
1091384350 12:83337-83359 TCTGCCTTCTCCTCTGGAATGGG - Intronic
1092935208 12:13355842-13355864 ACTGCCTTCTCCTATGGGAAAGG - Intergenic
1093146167 12:15569519-15569541 TCTACCTTCTGTAATGGAAAGGG + Intronic
1094103992 12:26789346-26789368 GCTGCTTACTGCAATGGAAAAGG - Intronic
1096347934 12:50866736-50866758 CCTGCCATCTCCACTGGAACAGG + Intronic
1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG + Exonic
1097134599 12:56841219-56841241 ACTACCTTCTGCGCTGGTAGTGG - Intergenic
1097148351 12:56957406-56957428 ACTACCTTCTGCACTGGTACCGG - Exonic
1097151978 12:56985904-56985926 ACTACCTTCTGCACTGGTACTGG - Intergenic
1097346338 12:58497630-58497652 CCTGCCTTCTGCTTTGCAAATGG - Intergenic
1099308725 12:80991260-80991282 ACTGGATTGTGCACTGTAAATGG + Intronic
1100059766 12:90560269-90560291 ACTGCTTTCTGCAGTCCAAAAGG + Intergenic
1103978556 12:124720534-124720556 ACTGCCTGCTTCTCTGGGAATGG - Intergenic
1104285619 12:127421901-127421923 TCTGCCTTCTCCACTAGAATAGG + Intergenic
1104294675 12:127501148-127501170 ACTTCCTTTTGCAATGGAATTGG + Intergenic
1104417864 12:128610122-128610144 ACTTGCTTCCTCACTGGAAAGGG - Intronic
1104575708 12:129964174-129964196 GCTGCCTTCAACAGTGGAAAAGG + Intergenic
1105551028 13:21395984-21396006 GCTGCCTTCTGGAGTGTAAAAGG - Intronic
1105627806 13:22130124-22130146 ACTGCCTTGTGAAGTGGGAAAGG + Intergenic
1109695284 13:65948425-65948447 ACTGTCTTCAGCAGTGGAAAAGG + Intergenic
1112048208 13:95618214-95618236 ACTCCCTTCTGTACTGTAAGCGG + Intronic
1112849514 13:103687460-103687482 TCTGCATTCTGCCCTTGAAAAGG + Intergenic
1113112877 13:106842999-106843021 ACTGCTTTATTAACTGGAAATGG - Intergenic
1115529930 14:34317665-34317687 GATCCCTTTTGCACTGGAAAGGG - Intronic
1117090838 14:52248358-52248380 ACTACTTTCAGCACTGGCAATGG - Intergenic
1117446056 14:55804841-55804863 GATGCCTCCTGCCCTGGAAAAGG - Intergenic
1118412075 14:65490840-65490862 ACTGCCATCTGCAAAAGAAATGG - Intronic
1121040244 14:90740415-90740437 ACTGGCTTCAGCACAAGAAAGGG + Intronic
1121305368 14:92903285-92903307 TCTGCCTTTTGCTGTGGAAAAGG - Intergenic
1121328981 14:93037723-93037745 GCTGCCTCCTGCAGTGGAGATGG + Intronic
1122880356 14:104688055-104688077 AAGGCCTTCTGCTCTGGAAGGGG + Intergenic
1125552152 15:40553269-40553291 ACTTCCTCCTGCACTTAAAAAGG - Intronic
1130068071 15:80622030-80622052 AATGCATTCTGCATTGTAAATGG - Intergenic
1130212539 15:81938313-81938335 ACTGCCTTCTTCACTTTCAAGGG - Intergenic
1130352237 15:83102933-83102955 AGTGGCTTCTGTACTGGACATGG - Intergenic
1130787529 15:87116463-87116485 ACTGCCTTCTGCAGTTGTCATGG + Intergenic
1132782314 16:1634324-1634346 ACTGCCTTCTGAAATTGACATGG - Intronic
1132818866 16:1851136-1851158 ACTGGCTTCTGCTCTGGATGGGG - Intronic
1133633738 16:7646582-7646604 ACTGCCAGATGCCCTGGAAAAGG - Intronic
1139231508 16:65287441-65287463 CCTGCCTTCTCAACAGGAAAAGG - Intergenic
1147038308 17:37698466-37698488 ACTTCCTGCTGCACTGAAAGTGG - Intronic
1148719892 17:49743956-49743978 TCTACCTTCCTCACTGGAAAAGG - Intronic
1148786276 17:50147730-50147752 ACTGCCTTCAGGAGGGGAAAGGG + Intronic
1150316086 17:64170476-64170498 ACTGCCTCATGCCCTGGCAAGGG + Intronic
1150562869 17:66310017-66310039 ACTGCTTTCAGTACTGGAAAAGG + Intronic
1153400531 18:4679361-4679383 ACTGCCACCTCCACCGGAAAAGG + Intergenic
1154439549 18:14375737-14375759 ACTGCTTGCTGCGCTGTAAAAGG - Intergenic
1156413084 18:36854692-36854714 ACTGCCTTGTGTACTTAAAATGG - Intronic
1156470430 18:37374308-37374330 ACCGCCCTGTGCACTGGCAAAGG - Intronic
1157133700 18:45033517-45033539 TCTGTCTTCTGCAGTGTAAAGGG + Intronic
1158294433 18:55979300-55979322 ACGGCCTTCTCCAGTGGAGACGG + Intergenic
1158490041 18:57901794-57901816 GCTGCCTTCTGGAATTGAAAGGG + Intergenic
1160054756 18:75467835-75467857 GCTGCCAGCTGCATTGGAAATGG + Intergenic
1161026276 19:2038784-2038806 TCTGCCTGCTGCGGTGGAAACGG + Exonic
1163578147 19:18122663-18122685 TCTGCCGTCTGCCCTGGAGAGGG - Exonic
1165320705 19:35083630-35083652 GCTGCCTGCTGGACTGGAGAGGG - Intergenic
1166100670 19:40569764-40569786 CCTGCCTCCTGCTCTGAAAAAGG - Intronic
1167018033 19:46854457-46854479 ATTGCCTCCTGCATTGGACAGGG - Intergenic
1168191574 19:54742079-54742101 ACTTCCTTCTGCACAGAGAAGGG + Exonic
1168193844 19:54758707-54758729 ACTTCCTTCTGCACAGAGAAGGG + Intronic
927201143 2:20578741-20578763 ACTGCCACCTGCACTGGACAGGG + Intronic
928374784 2:30765429-30765451 ACTGCCTTCTACCCTGTGAAGGG - Intronic
928467270 2:31533680-31533702 ACTGCCTTCTGCACTGGAAATGG - Exonic
928938222 2:36702547-36702569 CTTGCTTTCTGCAGTGGAAAGGG + Intronic
930865663 2:56120026-56120048 ACTCCCTCCTCCTCTGGAAAGGG - Intergenic
931525164 2:63145142-63145164 CCTGCCATCTCCACTGGAACAGG - Intronic
932420862 2:71600601-71600623 TGTGCCTTCTGAACTAGAAAGGG - Intronic
932840199 2:75074733-75074755 GCTGCCTTCTGCCATGGAGAAGG + Intronic
935172951 2:100624849-100624871 ACATCCTTCTGCAATGGCAAGGG + Intergenic
938101383 2:128500181-128500203 ACTTCCTTCTCCACTGAAGAAGG + Intergenic
940065071 2:149618532-149618554 AGTGCCTTCAGCACTGGAGGGGG + Intergenic
940160525 2:150707953-150707975 ACTTCCTTCTGCAAAGGCAAGGG + Intergenic
940791517 2:158034334-158034356 CTTGGCTTCTGCACTGGAAGAGG - Intronic
942028502 2:171935148-171935170 ATGGAATTCTGCACTGGAAAGGG + Intronic
945119317 2:206442611-206442633 CCTGACTTCTGCAGAGGAAAGGG - Intergenic
947702462 2:232245966-232245988 ACTGGCTTCTGCCCAGGAGATGG - Intronic
948102233 2:235384409-235384431 ACTGTCTTCTTAACTGTAAAAGG - Intergenic
948689483 2:239692826-239692848 ACTGAATTCTGCACTTTAAATGG - Intergenic
1169421358 20:5463368-5463390 ACTGTCCACTGCTCTGGAAAGGG - Intergenic
1175069119 20:56316803-56316825 ACTGCCACCTCCACTGGAACAGG + Intergenic
1175543411 20:59762381-59762403 AGTGGCTACTGCACTGGACAGGG - Intronic
1177410357 21:20721670-20721692 ACTGCCTTTAGAACTGGGAATGG + Intergenic
1179251766 21:39676610-39676632 GCTGCCTTGTCCACAGGAAACGG + Intergenic
1180660139 22:17460097-17460119 ACTGCCTTCTGGGCTGGAAGAGG - Intronic
1181573116 22:23778584-23778606 ACTGACTTGTGGACTGGACAAGG - Intronic
1181755015 22:25017593-25017615 ACTGCATTGTGAACTTGAAATGG + Intronic
1182291023 22:29279991-29280013 ACTGCTTTTTCGACTGGAAAAGG + Intronic
1182415740 22:30220471-30220493 ACTGAATTCTGCACTTTAAATGG + Intergenic
1184754874 22:46510027-46510049 CTTGCCTCCTGCCCTGGAAAGGG - Intronic
1185182748 22:49372626-49372648 TCTGCCGTCTGCACTGGGGACGG + Intergenic
949288899 3:2439811-2439833 AATGCCTCGGGCACTGGAAATGG - Intronic
950257097 3:11514382-11514404 ACTGCCTGCTGATCTGAAAAGGG - Intronic
954859387 3:53675003-53675025 TCTGCTTTCTGCTCTGGAAAAGG - Intronic
955702603 3:61696863-61696885 ATTGCCTTCTCCACTGATAACGG + Intronic
957418109 3:79931645-79931667 ACTGCCCTGTTCATTGGAAATGG + Intergenic
962036693 3:131659365-131659387 ATCCCCTTCTGCACTGAAAATGG - Intronic
962825062 3:139093946-139093968 ACTGCACACTGCACAGGAAAAGG - Intronic
963045647 3:141100942-141100964 TCTGTCTTGGGCACTGGAAAAGG - Intronic
963123221 3:141793695-141793717 ACTGCCTTCTGCAGCGGGGATGG - Intronic
963714784 3:148790622-148790644 ACTGCCTTCTGCACATGGAAGGG + Intergenic
964384225 3:156130218-156130240 ATTACCTTCTGCACTGGACATGG + Intronic
964659946 3:159109219-159109241 AATACCTTCTTCACTGCAAAAGG - Intronic
964872073 3:161324424-161324446 GCTGGCATCTGCACTGGGAAAGG + Intergenic
966877483 3:184331457-184331479 TCCACCTTCTGCAATGGAAAAGG - Exonic
968273680 3:197423849-197423871 ATTGCCTCCTGCACTGAAAGAGG - Intergenic
968620974 4:1603365-1603387 TCTGCCTTCTGCCCTGCAGAGGG - Intergenic
970323640 4:14900506-14900528 GCTGACTTCTGAACTGGAAAAGG - Intergenic
971345000 4:25803636-25803658 ACGGCCTTCTCCACTGTGAATGG + Intronic
971469352 4:27003816-27003838 CTTGCCTTCTCCACTGGTAAAGG + Intronic
972937264 4:44152320-44152342 ACAGCCTTCAGCAATTGAAATGG - Intergenic
976459441 4:85291805-85291827 ACTGGCTTGTGCACTCAAAATGG + Intergenic
977292403 4:95178064-95178086 ACTGCATTCTGCACTTCACATGG - Intronic
977467785 4:97403347-97403369 ACTGCTTACTCCCCTGGAAAGGG - Intronic
979425211 4:120555411-120555433 AGTGCCTTCCACACTGAAAATGG + Intergenic
980000576 4:127483036-127483058 ACTGGCTTCTGCAATGAGAAAGG - Intergenic
980536277 4:134127494-134127516 ACTGGGTTCTGAACTGGTAATGG - Intergenic
980726712 4:136770776-136770798 AATGACTTCTGCACAGCAAAAGG - Intergenic
980822429 4:138035311-138035333 AGAGCCTTCTGAACTGGAAATGG + Intergenic
980970110 4:139559580-139559602 ACTGCTTGCTGCAATGGAAGAGG - Intronic
981461160 4:145014691-145014713 ACTGCCACCTCCACTGGAATAGG + Intronic
982868934 4:160551307-160551329 GCTGTCTTCTGAAATGGAAATGG - Intergenic
983959159 4:173731454-173731476 AGTTCCTTATGCACTTGAAAGGG - Intergenic
983969866 4:173858296-173858318 GTTGACTTCTGCACTGGAGAGGG + Intergenic
985693310 5:1325526-1325548 GCTGCCGTCTGCACTGAAGACGG + Intronic
986004374 5:3656042-3656064 AAACCCTTGTGCACTGGAAATGG - Intergenic
986223099 5:5788125-5788147 ACTGCCTTGGTCACTGGGAAAGG - Intergenic
986452747 5:7882379-7882401 ACTGCCTTCTGCAAAGGCTATGG - Intronic
986600849 5:9471094-9471116 TCTGCTTTCTGCCTTGGAAAAGG + Intronic
986772165 5:10984173-10984195 AGGGCCTTCTGCTCTGGAAGAGG - Intronic
986913757 5:12589976-12589998 ACTGGCTTCTGCAGTGGATATGG - Intergenic
987665847 5:20937986-20938008 ATTGCCTTAAGCACTGGCAAAGG + Intergenic
988756841 5:34264180-34264202 ATTGCCTTAAGCACTGGCAAAGG - Intergenic
989440383 5:41464382-41464404 ATTGCCTTGTGCACTGAGAACGG + Intronic
992782545 5:80141377-80141399 GCTGCTTTCTGCAGAGGAAAGGG + Exonic
993059126 5:83017949-83017971 ACTTCCAACTGCACTGGAGATGG - Intergenic
994042463 5:95274371-95274393 CCTTCCATCTGCAATGGAAAAGG + Intronic
994209489 5:97072552-97072574 AGTGTCTTCTGTAGTGGAAAAGG + Intergenic
994591091 5:101773430-101773452 ACTGCTTTATGCACAGGGAAAGG + Intergenic
999067998 5:148712624-148712646 ACTTCCTTCTATTCTGGAAAGGG + Intergenic
999310017 5:150545875-150545897 CCTGCCTTCTCCACTGTGAATGG - Intronic
999717201 5:154370843-154370865 ACGGCCTACTGCACTGGCTAGGG - Intronic
999818562 5:155201280-155201302 CCTGCCACCTGCACTGGAACAGG + Intergenic
1000156698 5:158559296-158559318 AAAGCCTACTGCACAGGAAACGG - Intergenic
1000182601 5:158826414-158826436 ATTGCCTACTGCATTGGACACGG + Intronic
1000640158 5:163692685-163692707 AGTGCCTTCTGCTTTGGCAAGGG - Intergenic
1000929065 5:167230057-167230079 ACTGCATTCTGCCCTGCAACTGG - Intergenic
1002323808 5:178392204-178392226 ACTGACTTCTGCACTTTACATGG + Intronic
1002858440 6:1058427-1058449 AGTGCCTTCTTCCCTGGATATGG - Intergenic
1005853526 6:29841575-29841597 ACTGCATTGTGCACTTTAAATGG - Intergenic
1005934670 6:30511587-30511609 ACTGCATACTGCAAGGGAAAAGG + Intergenic
1007952122 6:45881807-45881829 ACAACCTTCTGCACTTGAAGAGG - Intergenic
1012097478 6:94981161-94981183 ATTACATTCTGCACTTGAAAAGG - Intergenic
1014569019 6:122986341-122986363 ACTGTTTACTCCACTGGAAAGGG + Intergenic
1015861030 6:137680028-137680050 ACTGGCTTCTGGACTGGAAAGGG + Intergenic
1016716169 6:147232560-147232582 ACTGCCTTATTTACAGGAAAAGG + Intronic
1017966707 6:159273056-159273078 ACTGCATTCTGCAGTTGAATGGG - Intergenic
1018785434 6:167104409-167104431 ACCGCCATGTGCAATGGAAAAGG - Intergenic
1018787018 6:167116405-167116427 GCTGCCTCCTGTGCTGGAAAGGG - Intergenic
1018883513 6:167910285-167910307 ACAGCCTTCTGCCCTGCCAATGG + Intronic
1018923068 6:168189194-168189216 AGTGACTTCTTCCCTGGAAATGG - Intergenic
1019739970 7:2667895-2667917 CCTGGCTGCTGCACTGGGAAGGG + Intergenic
1021982564 7:26068859-26068881 ACTGGCATCAGCACAGGAAAGGG + Intergenic
1022276764 7:28862844-28862866 ACAGCCCTCTGGAGTGGAAAAGG - Intergenic
1022284104 7:28938727-28938749 AGTGCCATGTGCACAGGAAAGGG - Intergenic
1027164304 7:75823630-75823652 ACAGACTTCTGCCCTGGAAAGGG + Intergenic
1027445568 7:78269744-78269766 AAGGCCTTCTGCACAGCAAAAGG - Intronic
1028443509 7:90892054-90892076 ACTTGTTTCTGCCCTGGAAATGG + Intronic
1030642416 7:112021506-112021528 ACTTCCTCCTGCACTGTAAGTGG - Intronic
1032108471 7:129054903-129054925 AGAGCCTTCTGCCCTGGTAACGG - Exonic
1032690903 7:134285533-134285555 ACTGCCAACTGAACTAGAAATGG + Intergenic
1033506694 7:142010119-142010141 ACTTCCTCCTGTACTGGAAAAGG - Intronic
1035989880 8:4477602-4477624 ACTGACTTCTGCACAGAGAAAGG + Intronic
1037692986 8:21198343-21198365 CCTCACTTCTGCACTGGACAGGG + Intergenic
1042631217 8:70818939-70818961 ACAGACTTCTTCCCTGGAAAAGG + Intergenic
1042772782 8:72397554-72397576 CCTAGCTTCTGCTCTGGAAAGGG + Intergenic
1044338697 8:91021358-91021380 ACTGGCGTCTGGACTGGCAATGG + Exonic
1044793637 8:95873224-95873246 ACTGCCTTCTTTCCTGCAAATGG + Intergenic
1048202940 8:132391862-132391884 ACTGCTTCCTGCACTGGCGAGGG + Intronic
1048309665 8:133310888-133310910 ACTGTCTTCTTCACTTAAAAAGG + Intergenic
1051644433 9:19253424-19253446 ACTGCCTTGTGTTCTGAAAAAGG + Intronic
1053351909 9:37418726-37418748 ACTGCCCTGAGCACTGGACATGG + Intergenic
1056937878 9:90931458-90931480 ACTCCCTTCTGTCCTGTAAATGG + Intergenic
1057302336 9:93894235-93894257 ACGTCCATCAGCACTGGAAAGGG + Intergenic
1057444529 9:95104356-95104378 ACTGGCGTCTGCTCTGGGAATGG + Intronic
1057503757 9:95616164-95616186 ACTGGATTCTGGACTGGAGAGGG + Intergenic
1058119046 9:101118458-101118480 ACTGATATCTGCACTGGGAAGGG + Intronic
1059873259 9:118601907-118601929 ACCTCCTTCTGCTCTGCAAAAGG + Intergenic
1062000233 9:134212158-134212180 ACTGCCCTCTGGCCTGGCAAGGG + Intergenic
1186023533 X:5283686-5283708 ACTGCCATCTGTACAAGAAAGGG + Intergenic
1186061062 X:5707910-5707932 ACTGCTTTCTGAACTGGATCTGG - Intergenic
1189322503 X:40095391-40095413 ACTTCCTGTGGCACTGGAAACGG - Intronic
1189364678 X:40379471-40379493 ACTGCCTTCTGCATGAGTAATGG + Intergenic
1191148130 X:57190386-57190408 ACTGTTTGCTGCCCTGGAAAGGG - Intergenic
1193389148 X:80906255-80906277 ACTGTTTACTGCCCTGGAAAGGG + Intergenic
1196464879 X:115961164-115961186 TCTGCCATCTCCACTGGAACAGG + Intergenic
1198944403 X:141994721-141994743 ACGGCCTTCTCATCTGGAAAAGG + Intergenic