ID: 928468050

View in Genome Browser
Species Human (GRCh38)
Location 2:31541776-31541798
Sequence ATGGACAGTACAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 11, 3: 95, 4: 293}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928468042_928468050 28 Left 928468042 2:31541725-31541747 CCCTCTGGCAGCAGCCACATAGC 0: 1
1: 1
2: 1
3: 32
4: 200
Right 928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG 0: 1
1: 0
2: 11
3: 95
4: 293
928468043_928468050 27 Left 928468043 2:31541726-31541748 CCTCTGGCAGCAGCCACATAGCA 0: 1
1: 3
2: 17
3: 29
4: 257
Right 928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG 0: 1
1: 0
2: 11
3: 95
4: 293
928468044_928468050 14 Left 928468044 2:31541739-31541761 CCACATAGCACAGAGAGACAATC 0: 1
1: 0
2: 7
3: 46
4: 199
Right 928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG 0: 1
1: 0
2: 11
3: 95
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928468050 Original CRISPR ATGGACAGTACAGTGATTGT GGG Intronic
901524066 1:9808209-9808231 ATGGAAAATACAGTATTTGTGGG - Intronic
902977185 1:20097553-20097575 GCAGACAATACAGTGATTGTGGG + Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908595748 1:65687033-65687055 ATGGACAGTACAGGTATAGCAGG - Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909663707 1:78111089-78111111 ATGGAAAGTACAGAAACTGTTGG + Intronic
910321685 1:85953061-85953083 ATGGAGAATACATTGCTTGTTGG - Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911374188 1:97030591-97030613 ATGGCCAGTAGTGGGATTGTTGG - Intergenic
912559898 1:110543224-110543246 ATGGACATTACAGTGATTTATGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915185825 1:154104529-154104551 CTGGGGAGTACAGTGATTGTGGG + Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
917171677 1:172183445-172183467 AAGGAAAATACAGTGATTCTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918557765 1:185824566-185824588 ATGGACACTATATTGGTTGTAGG + Intronic
919047384 1:192470421-192470443 AGGGAAAGTGAAGTGATTGTGGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
919607330 1:199700875-199700897 ATGGACAGTTCTGTGGTTTTTGG - Intergenic
919835372 1:201569621-201569643 AGGGAAGGTACAGTGATTCTGGG + Intergenic
921040725 1:211429183-211429205 ATTGACAATACAGTATTTGTGGG + Intergenic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921774669 1:219082784-219082806 AGAGACAGCTCAGTGATTGTGGG - Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076242795 10:128922450-128922472 TTGGAGAATACAGTGATTCTGGG - Intergenic
1076376709 10:129993146-129993168 AAGGAAAGCACGGTGATTGTGGG + Intergenic
1076743861 10:132502939-132502961 GTGGGCAGTTCAGTGGTTGTTGG - Intergenic
1077577476 11:3395562-3395584 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1077603975 11:3594680-3594702 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1083514645 11:63245318-63245340 ATGGAAAGTAAAGTTATTGCGGG + Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1084226427 11:67717497-67717519 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1084229427 11:67740344-67740366 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1084259872 11:67969272-67969294 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1084812899 11:71625980-71626002 AAGGGCAGTTCAGTGAATGTAGG + Intergenic
1084845871 11:71899352-71899374 AAGGGCAGTTCAGTGAGTGTAGG + Intronic
1085144024 11:74176504-74176526 ATGTACAATTCAGTGATTTTTGG + Intronic
1085264807 11:75230934-75230956 CTGGCCAGTACATTGATTATTGG - Intergenic
1085448123 11:76614828-76614850 ATGGACAGTAGACTGATTTTTGG - Intergenic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1086299652 11:85412922-85412944 ATAGCCAGTACTGAGATTGTTGG + Intronic
1087370595 11:97279249-97279271 AGGGACAGTGCAGGGATTGGAGG + Intergenic
1087473098 11:98601647-98601669 AAGGAAAGCACAATGATTGTAGG - Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1092434077 12:8432434-8432456 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1093273747 12:17098052-17098074 TTGGACAGTCCAGTAATAGTAGG - Intergenic
1095523017 12:43090649-43090671 ATTCACAGTTTAGTGATTGTTGG + Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099523213 12:83689423-83689445 AAAGACAGTGCGGTGATTGTGGG + Intergenic
1100444006 12:94644229-94644251 ATTCACAGTACAGTGATTCATGG + Intronic
1101252100 12:102946556-102946578 AGGGACAGCAAAGGGATTGTGGG - Intronic
1102770486 12:115471857-115471879 GTGGACAGTAAAGTCAGTGTAGG + Intergenic
1106953010 13:34905885-34905907 ATGGACAGTGGAGGGATTGTAGG - Intergenic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1113217495 13:108060162-108060184 ACCGAGAGTGCAGTGATTGTAGG + Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1117608164 14:57453500-57453522 ATGGAAAATACAGTGTTTGCAGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1122572971 14:102720548-102720570 GTGGACAGCACAGTGATCTTGGG + Intronic
1125664036 15:41416553-41416575 ATGGCCAGAGCAGAGATTGTGGG - Intronic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127187048 15:56490911-56490933 ATGAACAGAGCAGTGATTCTCGG + Intergenic
1128258516 15:66215715-66215737 ATAAACAGTTCAGTGAATGTTGG + Intronic
1129086133 15:73094215-73094237 ATGGACAGTAGACTGCTTATGGG - Intronic
1129974388 15:79809908-79809930 ATGGACTCTACAGTGTCTGTTGG - Intergenic
1130058459 15:80551092-80551114 ATCGAAAATACAGTGAGTGTTGG - Intronic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1134407164 16:13970585-13970607 TGGGACAGCACAGTGATTGCAGG - Intergenic
1135821284 16:25688753-25688775 AAGGACAGTACAGTGTGTGGTGG - Intergenic
1137329850 16:47482324-47482346 AAGGACAGTACAGAGTTTGTAGG - Intronic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1139520341 16:67479192-67479214 ATCGGCAGTACAATAATTGTAGG - Intronic
1140693833 16:77511976-77511998 AGGGACTGTCCTGTGATTGTAGG - Intergenic
1141277292 16:82600187-82600209 ATGAACAGTTCACTGATTTTTGG - Intergenic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1144319240 17:14097719-14097741 ATTGACAGTTCAGTGATTATGGG + Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146242678 17:31244616-31244638 ACGGACAGCACAGTGATTATGGG - Intronic
1148680522 17:49470912-49470934 AATGACAGTACAGGGATTCTTGG - Intronic
1148948304 17:51285347-51285369 ATGGACAGTATGTTGCTTGTGGG + Exonic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149535258 17:57428794-57428816 ATGGACAATACAGCGAGGGTGGG - Intronic
1150336976 17:64337440-64337462 AGGGATAATACAGTGACTGTGGG + Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1154945466 18:21157781-21157803 ATGGGCAGTACAGTGCATGAAGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159303815 18:66613836-66613858 AGGAAAAGTACAGTGATTGAAGG - Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
925194883 2:1914832-1914854 ATGGAAAAGACAGTGGTTGTGGG - Intronic
925484838 2:4316526-4316548 AAGGACAGTACAGTAATTGTGGG - Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
926867164 2:17372620-17372642 ATGGACAGAACAGTGTGTGGAGG - Intergenic
927375394 2:22407398-22407420 ATGGACAAGACAGCGTTTGTCGG + Intergenic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
929281837 2:40088203-40088225 AAGGAAAGTGCAGTGACTGTGGG - Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930588326 2:53296919-53296941 ATGGAGAGTACAAGGATGGTTGG + Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
932101144 2:68900382-68900404 AAGGACAGCAAGGTGATTGTAGG + Intergenic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
936511403 2:113150406-113150428 AGGGATAGTGCAGTGATTGCCGG - Intergenic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937079603 2:119130987-119131009 CTGGGCAGTGCAGTGTTTGTAGG - Intergenic
938821693 2:134966876-134966898 AAGGGCAGTTCAGTGAGTGTAGG + Intronic
940468568 2:154064074-154064096 ATGGAGAGGCCAGTGATTATAGG + Intronic
940630192 2:156229170-156229192 ATGGACAGAACAGTGTATGAAGG + Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
940839229 2:158559853-158559875 AGGGCCAGTACAGGGATGGTGGG - Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
946142467 2:217703388-217703410 ATGGTCTGTACACTGAGTGTAGG - Intronic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948306068 2:236947821-236947843 AAACACAGTACAGTGATGGTAGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170142006 20:13133775-13133797 AGGGATGGTCCAGTGATTGTAGG + Intronic
1170293795 20:14801837-14801859 AAGGAAAGTACAGTGATGCTCGG - Intronic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1174662787 20:52228816-52228838 ATGGACAGGGCAGTGAGGGTGGG - Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1179652382 21:42820035-42820057 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1180234468 21:46449255-46449277 ATGAACAGAACAGCGATTTTAGG - Intergenic
1182746564 22:32610303-32610325 ATGTACAGTTCAGTGCTTGTAGG + Intronic
949151968 3:780015-780037 ATGGAAATTACAGTGTTGGTGGG - Intergenic
949251471 3:1989554-1989576 ATGGAAAGCACATGGATTGTTGG - Intergenic
950312495 3:11970700-11970722 ATGGACAGTACTGTGAATGCTGG - Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952068941 3:29609406-29609428 CTGGATTGTACAGTGATTCTGGG + Intronic
952688486 3:36176245-36176267 AGGAAAAGTGCAGTGATTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
955510610 3:59676847-59676869 ATGGAAAATACAGTGATAGAGGG - Intergenic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
957039468 3:75326358-75326380 TTGGACAGTACAGTCGTCGTTGG + Intergenic
957046004 3:75375174-75375196 AAGGACAGTTCAGTGAGTGTAGG - Intergenic
957074826 3:75593695-75593717 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
957977087 3:87460578-87460600 AGGGACAGAAAAGTAATTGTAGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
961044194 3:123697636-123697658 GTGGACAGTACAGTCATTGTTGG + Intronic
961276380 3:125730436-125730458 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
961875118 3:130016582-130016604 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
961878057 3:130039294-130039316 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964216188 3:154286195-154286217 ATTGAGAGTAAAGTGTTTGTTGG - Intronic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
965853942 3:173065698-173065720 AGGGAAAGTAAAGTGAGTGTGGG + Intronic
965943714 3:174214755-174214777 ATGGTCAGTAGGGTGATTGGTGG + Intronic
966769784 3:183493433-183493455 ATGTACAACACAGTCATTGTAGG - Intronic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968990272 4:3906330-3906352 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
969018426 4:4121333-4121355 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
969023114 4:4151520-4151542 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
969730695 4:8955563-8955585 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
969735557 4:8987385-8987407 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
969786863 4:9465192-9465214 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
969790292 4:9489671-9489693 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
969794777 4:9518840-9518862 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
969825051 4:9751036-9751058 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG + Intronic
971867353 4:32189963-32189985 ATGGACAGCACGTTGATGGTGGG + Intergenic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
972579054 4:40379169-40379191 GAGGACAGTGCAGTGATTATGGG + Intergenic
972676489 4:41264695-41264717 CTGGACAGAAAAGTGATTCTGGG + Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
974877136 4:67714582-67714604 ATGGTGGGGACAGTGATTGTTGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976684166 4:87792512-87792534 AGGTACATTACAGTGAGTGTGGG + Intergenic
976748328 4:88428391-88428413 ATGGAAGGTGGAGTGATTGTAGG - Intronic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
977993142 4:103469077-103469099 CCTGACAGTACATTGATTGTTGG - Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978733686 4:112061326-112061348 AGGGACAGCACAGTGATCATGGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981394597 4:144233255-144233277 AGGGACAGTGCATTGATTGAGGG + Intergenic
982859083 4:160426065-160426087 TTGGTCAGTCCAATGATTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
991570797 5:68051333-68051355 ATGGACAGGACTGTGTGTGTCGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994217974 5:97159917-97159939 ATGAAGAGTGCAGTGACTGTGGG - Intronic
994320334 5:98387314-98387336 AGGGGAAGTGCAGTGATTGTGGG - Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
996906691 5:128608971-128608993 AAGAACAGCACAGTGACTGTGGG - Intronic
997346257 5:133194634-133194656 ATGCACAGGACAATGCTTGTTGG + Intergenic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
999442570 5:151613974-151613996 ATGCACAGTGCAGGGTTTGTTGG + Intergenic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1003593040 6:7451768-7451790 GTGTACAGTTCAGTGATTTTTGG - Intergenic
1003900790 6:10653629-10653651 ATGGAAAATACAGTATTTGTGGG - Intergenic
1005524141 6:26629032-26629054 ATGGAAAATACAGTATTTGTGGG + Intergenic
1006205689 6:32340444-32340466 ACTGACAGTTCAGTGATTGACGG - Intronic
1008238792 6:49083692-49083714 ATGAAGAGTGCAGTGATGGTGGG + Intergenic
1008504341 6:52214901-52214923 AAGGACAGTAAATTGATTATAGG + Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1011029163 6:82902581-82902603 AAGGACAGAGCAGTGATTGCAGG + Intronic
1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG + Intergenic
1012059769 6:94463420-94463442 AAGGAAAGCTCAGTGATTGTGGG - Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014378651 6:120711156-120711178 ACGGAGAGTCCACTGATTGTGGG + Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016119011 6:140324760-140324782 ATGGAGATTACAATGATTTTAGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017242009 6:152181000-152181022 ATGTACAGTTCAGTGCTTTTGGG + Intronic
1017281036 6:152626197-152626219 ATGAAGAGTAGAGTGTTTGTAGG + Intronic
1020310164 7:6861244-6861266 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1020313102 7:6884384-6884406 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1020352473 7:7236352-7236374 ATGGATAGAACAGTGAATGCAGG - Intronic
1020566169 7:9798487-9798509 ATGAATAGGACTGTGATTGTTGG - Intergenic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021022889 7:15625667-15625689 ATGGACAGTGCAGTTATGATTGG - Intronic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021884984 7:25129436-25129458 AGGGACAGGGCAGTGATTGCAGG - Intergenic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022223700 7:28340921-28340943 AGAGACAGCACAGTGATTATGGG - Intronic
1022529539 7:31058217-31058239 TTGGACAGTACAGGGATGGCTGG + Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023315776 7:38934854-38934876 ATGGACAGGACTGTGATTGAAGG - Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1026226047 7:68442052-68442074 ATAAACATTACAGTGATTGTAGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028794419 7:94887474-94887496 GTGGACAGTTGAGTGATTGAGGG + Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029076914 7:97942041-97942063 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1030431723 7:109456350-109456372 AAGAACAGCACAGTGATTATCGG - Intergenic
1031272164 7:119665715-119665737 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1032212517 7:129928972-129928994 ATTGACAGTGCACTCATTGTTGG - Intronic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034878215 7:154743885-154743907 ATGGAAAGTACAGTATTTGAGGG - Intronic
1035517275 8:246127-246149 AAGGACAGAAGAGTGATTGAAGG - Exonic
1036240862 8:7079927-7079949 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
1036705290 8:11041944-11041966 ATATACAGTACAATGAGTGTGGG - Intronic
1036902292 8:12679428-12679450 AAGGGCAGTTCAGTGAATGTAGG - Intergenic
1038067273 8:23975996-23976018 CTGGAGAGGACAGTGTTTGTGGG + Intergenic
1038815013 8:30893419-30893441 ATGGACAGTACAATGACTTACGG + Intergenic
1040929994 8:52723551-52723573 AGGGACAGAATAGTGACTGTTGG - Intronic
1042359740 8:67868856-67868878 ATGGTCAGAGCAGTGAATGTGGG + Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043488210 8:80719904-80719926 ATGGAAAGTACCGAGATTGATGG + Intronic
1044149320 8:88754849-88754871 AAGGACAATTCAGTGAGTGTGGG - Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047842261 8:128766244-128766266 ATGGACAGAACAGTGTGTGGAGG + Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048980454 8:139701104-139701126 ATGCACAGGGCAGTGATTCTGGG - Intronic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051497209 9:17736796-17736818 ATGAAAAGTACAGTAATTGACGG - Intronic
1051593019 9:18795530-18795552 ATGAACAGAACAGGGATTTTTGG - Intronic
1051828487 9:21248893-21248915 ATGGCCAGTACTGGGATTGCTGG - Intergenic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1058341726 9:103905312-103905334 ATTGACAGGACAGAGATTCTAGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1187438560 X:19295444-19295466 GTGGACAGTTCAATGATTTTTGG + Intergenic
1187564543 X:20435374-20435396 ATGGTCAGTACTGTGACTATAGG + Intergenic
1187575125 X:20545995-20546017 AGGGACAGCACAGCAATTGTGGG - Intergenic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1189640650 X:43067449-43067471 AAGGAAAGTGTAGTGATTGTGGG + Intergenic
1189902824 X:45725103-45725125 ATACACAGTACTGGGATTGTGGG - Intergenic
1191593322 X:62913011-62913033 ATGTAAAAGACAGTGATTGTGGG - Intergenic
1191878293 X:65818992-65819014 ATGCAAAGTACTGAGATTGTAGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192487546 X:71542602-71542624 ATGGCCATTACAGTCATTGTTGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193150401 X:78118661-78118683 AGGGACAGTACAGTAATTTGGGG + Intronic
1193336582 X:80296852-80296874 ATGGACAGTTCATGTATTGTGGG + Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194095647 X:89636024-89636046 AGGGACAGCACAGCAATTGTGGG + Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195178657 X:102335116-102335138 ATGGCCAGTAGTGTGATTGCTGG - Intergenic
1195180207 X:102351967-102351989 ATGGCCAGTAGTGTGATTGCTGG + Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196530521 X:116781737-116781759 ATGGACAGAACAGTGTATGGAGG + Intergenic
1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG + Intergenic
1197030595 X:121809192-121809214 AGGGACAGTGAAGTGAATGTGGG - Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198037502 X:132815946-132815968 ATGTACAGTTCAGTGATTTTTGG - Intronic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1200448646 Y:3297392-3297414 AGGGACAGCACAGCAATTGTGGG + Intergenic