ID: 928468976

View in Genome Browser
Species Human (GRCh38)
Location 2:31554634-31554656
Sequence TTGGCTCATCCCTTCTAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928468972_928468976 11 Left 928468972 2:31554600-31554622 CCTTGCATGTTGAGAATGATCAC 0: 1
1: 0
2: 1
3: 4
4: 123
Right 928468976 2:31554634-31554656 TTGGCTCATCCCTTCTAAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928468976 Original CRISPR TTGGCTCATCCCTTCTAAGG TGG Intronic
901311928 1:8276082-8276104 TTGGCTCTTCACTTCAGAGGGGG - Intergenic
909418835 1:75439280-75439302 TTGGCTCATGGCTCCAAAGGTGG - Intronic
912935424 1:113999956-113999978 TTGATTCCTCTCTTCTAAGGGGG - Intergenic
916108128 1:161445239-161445261 TGGGCTCATCTGTGCTAAGGAGG + Intergenic
916109714 1:161452619-161452641 TGGGCTCATCTGTGCTAAGGAGG + Intergenic
916111299 1:161460029-161460051 TGGGCTCATCTGTGCTAAGGAGG + Intergenic
916112887 1:161467410-161467432 TGGGCTCATCTGTGCTAAGGAGG + Intergenic
922994947 1:229948648-229948670 TTGGCTCATGGCTTCTCAGGAGG - Intergenic
923268581 1:232334999-232335021 GTGGCTCATCCTTCCCAAGGTGG - Intergenic
1065109603 10:22426790-22426812 GTGGCTCATTCCTTCTAAACTGG - Intronic
1066101655 10:32123084-32123106 GAGCCTCATCCCTTCTAAGTTGG - Intergenic
1070106549 10:73438031-73438053 TTGGGTCATCGCTGCCAAGGTGG - Exonic
1074307626 10:112293540-112293562 TGTCCTCATCCCTTCTAAGATGG + Intronic
1076122544 10:127947910-127947932 TTGGCTCAACCCCTCTAATTAGG - Intronic
1076122742 10:127949230-127949252 TTGGCTCAACCCTTCTAATTAGG - Intronic
1076621330 10:131790091-131790113 TTGGCTCAGCCCTTCACAGGTGG + Intergenic
1078866506 11:15302679-15302701 TTGGGTCATCCCTCCTGATGAGG + Intergenic
1080779552 11:35418532-35418554 TTGGCTCATTCCTTCCGAGCCGG + Intronic
1084487231 11:69455707-69455729 TTGGATCATCCTCTCTAACGTGG + Intergenic
1085338981 11:75719152-75719174 TTGGCTCATCTGTGCAAAGGGGG - Intronic
1086493332 11:87377602-87377624 TTGGCTCAGCCCCTTGAAGGAGG + Intergenic
1090366336 11:126209719-126209741 TTGGCTTTTTCCTTCTTAGGTGG - Exonic
1094315330 12:29133269-29133291 GTTGCTCATCCCTTCAAAAGTGG + Intergenic
1100264348 12:92961332-92961354 TTAGCTCCTACCTTCTAAGTTGG + Intergenic
1101963872 12:109268877-109268899 TTGGCCCATCCCTGGTGAGGGGG - Intergenic
1102045831 12:109829668-109829690 TTGGGTCATCCCTGCAAAGTGGG + Intronic
1105743356 13:23352181-23352203 GTGGCAGATCCTTTCTAAGGTGG - Intronic
1113105737 13:106770110-106770132 TTGGCAGGTCCCTACTAAGGAGG + Intergenic
1115112289 14:29839024-29839046 TTGTCTCATCCCTTCTTAAAAGG - Intronic
1119539536 14:75428982-75429004 TCTGCTCCTCCCTTCAAAGGAGG + Intronic
1122340797 14:101027327-101027349 ATGTCTTATCCCTTCTTAGGAGG + Intergenic
1126041497 15:44595408-44595430 TTGGATCATCACTTCTGTGGAGG - Exonic
1128612271 15:69083721-69083743 TTGGCTCACCCCAACCAAGGAGG - Intergenic
1140776268 16:78251160-78251182 CTGGCTCTTCCCATCTAATGTGG + Intronic
1142283885 16:89163297-89163319 TTGCCTGATGCCTTCCAAGGAGG + Intergenic
1143983585 17:10891999-10892021 TTGCCTCAGCCCTGCTAAGCAGG + Intergenic
1144149268 17:12427680-12427702 TCCCCTCATCCCTTCTACGGGGG - Intergenic
1144331225 17:14225815-14225837 TTGCATCATCTCCTCTAAGGTGG - Intergenic
1144944186 17:18961423-18961445 GGGGCTCCTCCCTTGTAAGGAGG + Intronic
1152307951 17:79532099-79532121 TGGCCTCATTCCTTCTCAGGTGG + Intergenic
1152735570 17:81995396-81995418 GTGGCTCATCCCCTCAAGGGAGG - Intronic
1152876457 17:82789339-82789361 CTGGCCCATCCCTGCTGAGGTGG + Intronic
1162916337 19:13876512-13876534 TTTGCTCATCCATTCAATGGGGG + Intronic
1164581524 19:29438333-29438355 GTGCCTCATCCCATCTCAGGTGG + Intergenic
1166388019 19:42392887-42392909 GTGCCCCATTCCTTCTAAGGGGG - Intergenic
926292868 2:11544559-11544581 TTGGCTGTTCTATTCTAAGGAGG + Intronic
928468976 2:31554634-31554656 TTGGCTCATCCCTTCTAAGGTGG + Intronic
933972764 2:87483565-87483587 CTTCCTCATCCCTTCCAAGGAGG - Intergenic
935028589 2:99301068-99301090 TGGGCTCACCACCTCTAAGGAGG - Exonic
935029397 2:99307439-99307461 TGGGCTCACCACCTCTAAGGAGG + Intronic
936320954 2:111466648-111466670 CTTCCTCATCCCTTCCAAGGAGG + Intergenic
939087769 2:137742218-137742240 TTGACTCATCCCATTAAAGGAGG - Intergenic
944928115 2:204486055-204486077 TTGGCTCATTCCTTTTTATGTGG + Intergenic
945288784 2:208108110-208108132 TTTGCTGAGCCCTTCCAAGGAGG + Intergenic
945381685 2:209147779-209147801 TTTGCTGAGCCCTTCCAAGGAGG - Intergenic
945958548 2:216108559-216108581 TTGACTCCTCCCTTCCAAGCTGG + Intronic
947074231 2:226324748-226324770 CTGGCTCTTCCCTTTTAAGGGGG + Intergenic
947773705 2:232691064-232691086 GTGGCTCATGCCTGCTGAGGCGG - Intergenic
1170055925 20:12202256-12202278 GTGGCTCACCCGTTCTAAGACGG + Intergenic
1173414906 20:42846729-42846751 TTGGCTCCTACCTTCTGAAGTGG + Intronic
1175654700 20:60759979-60760001 TTGGGTCATTCCTTCTAGGGAGG - Intergenic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1182116188 22:27757834-27757856 ATGGCCCTGCCCTTCTAAGGAGG - Intronic
1182481115 22:30609408-30609430 CTGGCCCCTTCCTTCTAAGGAGG + Intronic
1184242759 22:43220111-43220133 TTGGCTCAACCATTCTAGGGGGG + Intronic
1184985939 22:48134171-48134193 TTTGATCATCCCTTCTAAAGAGG + Intergenic
950210976 3:11123067-11123089 TTGACGCATCCCTTATAAGGTGG - Intergenic
955298103 3:57751924-57751946 GTGGCACATGCCTACTAAGGAGG + Intergenic
956416677 3:69038296-69038318 TTTGCTCTTCTCTTCTAAGAGGG + Intronic
957003720 3:74918274-74918296 TTTTCTCTGCCCTTCTAAGGGGG + Intergenic
960445647 3:117745921-117745943 GTGGCACATTCCTTCCAAGGGGG - Intergenic
962125932 3:132617713-132617735 TTGGCTCATCCTTTCAATGAAGG + Intronic
966331867 3:178823655-178823677 TTGGCTGATCCCTTCTGGGCTGG - Intronic
971492396 4:27226887-27226909 TTGCTTCTTCCCTTCTAAAGTGG + Intergenic
976765949 4:88597728-88597750 CCGGATCATCCCCTCTAAGGTGG - Intronic
979687038 4:123522180-123522202 CTGCCTCATCCCTTTTCAGGTGG - Intergenic
981929398 4:150173549-150173571 TAGGCTCAGCACTTCAAAGGAGG - Intronic
985608715 5:873799-873821 TTGGCTCATGGCTCCCAAGGAGG - Intronic
987115405 5:14722741-14722763 TTAGCTGCTCCCCTCTAAGGTGG + Intronic
990222630 5:53609812-53609834 TTGGCTCATGAGGTCTAAGGAGG - Intronic
997460005 5:134045568-134045590 TTGTCTCATCTCTTCTAATATGG + Intergenic
999304951 5:150513574-150513596 TGTGCACAGCCCTTCTAAGGAGG + Intronic
1002355784 5:178627464-178627486 TTGGCGCTTCCAGTCTAAGGTGG + Intronic
1010628580 6:78168976-78168998 TTTCCTCATCTCTTCTTAGGAGG - Intergenic
1014700444 6:124680264-124680286 TTGGCTTCTCCTTTATAAGGAGG - Intronic
1016332861 6:142972012-142972034 ATGGATCATCCTTTCTAATGGGG - Intergenic
1016957893 6:149644064-149644086 TCAGCTCATCCCTTCCAAGCTGG + Intronic
1020748449 7:12109544-12109566 TTGGCTTATCCGTTATCAGGAGG - Intergenic
1025228275 7:57181928-57181950 GTGGCTCATCCCTGTTAAAGGGG - Intergenic
1025590845 7:62858899-62858921 TTGGCTCCTCCCTCCTCAGAAGG - Intergenic
1026906700 7:74066851-74066873 CTGGCTCAGCCCTTCTGAGCAGG - Intronic
1030508764 7:110457078-110457100 TTGGCTCAGCCCATCTACAGTGG + Intergenic
1030902115 7:115137407-115137429 TTTGTTCATCCATTCAAAGGAGG + Intergenic
1030992348 7:116315507-116315529 TGAGCTCATTCCCTCTAAGGAGG + Intronic
1031556322 7:123180972-123180994 TGGGATCATGCCTTCTAAGAAGG - Exonic
1031812906 7:126394363-126394385 TTGGCTCTGCTCTTCTGAGGTGG - Intergenic
1032258135 7:130313105-130313127 TTGGCTACTTCCTTCTTAGGAGG + Intronic
1033636375 7:143215130-143215152 TTACCTCCTCTCTTCTAAGGAGG - Intergenic
1035651473 8:1269113-1269135 TTGGCTCACCCCTTCATCGGTGG + Intergenic
1036032338 8:4988214-4988236 TTGCCTCATCCTTTGTAAAGCGG - Intronic
1037153237 8:15665817-15665839 TGGTCTCATGCTTTCTAAGGGGG + Intronic
1047293619 8:123551745-123551767 TTTCCTCATCCCTTGCAAGGAGG - Intergenic
1047929208 8:129709928-129709950 TTTGATCATCTCATCTAAGGTGG + Intergenic
1048161363 8:132024773-132024795 TCTGCTCTTTCCTTCTAAGGTGG - Exonic
1048386078 8:133913723-133913745 CTGGCTCCTGCCTTCTAAGACGG - Intergenic
1053267446 9:36725594-36725616 CTGGTTCATCGATTCTAAGGTGG - Intergenic
1053935918 9:43151248-43151270 TTTCCTCTTCCCTTCTTAGGAGG + Intergenic
1056896175 9:90552768-90552790 TTGGCTTCTCCCATCTTAGGTGG - Intergenic
1056936845 9:90921501-90921523 CAGGCTCATCCCTTCTGAGCAGG - Intergenic
1186135594 X:6516905-6516927 TTGGATCATCCCTTGTTAGATGG - Intergenic
1188801301 X:34533636-34533658 TTGTCTGCACCCTTCTAAGGAGG + Intergenic
1189735984 X:44070358-44070380 TAGGATCATACCTTCTTAGGTGG - Intergenic
1190642408 X:52493488-52493510 TTGTCTCATCCCTCCTCAGAGGG + Intergenic
1190645265 X:52519379-52519401 TTGTCTCATCCCTCCTCAGAGGG - Intronic
1191640597 X:63427177-63427199 AAGGATCATCCCTTCTAAGATGG - Intergenic
1194163026 X:90478913-90478935 TTGAGATATCCCTTCTAAGGTGG - Intergenic
1199656337 X:149998679-149998701 TTTCCTCATTCCTCCTAAGGGGG + Intergenic
1200509303 Y:4056645-4056667 TTGAGATATCCCTTCTAAGGTGG - Intergenic