ID: 928469074

View in Genome Browser
Species Human (GRCh38)
Location 2:31555547-31555569
Sequence GTTTCAGAAAGGCCGTCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928469074_928469079 22 Left 928469074 2:31555547-31555569 CCTAAGGACGGCCTTTCTGAAAC 0: 1
1: 0
2: 1
3: 18
4: 124
Right 928469079 2:31555592-31555614 AAGAGCTGGAGAAAGAAACCAGG 0: 1
1: 0
2: 3
3: 60
4: 604
928469074_928469077 8 Left 928469074 2:31555547-31555569 CCTAAGGACGGCCTTTCTGAAAC 0: 1
1: 0
2: 1
3: 18
4: 124
Right 928469077 2:31555578-31555600 GCAAAAGTAGAGCCAAGAGCTGG 0: 1
1: 0
2: 0
3: 26
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928469074 Original CRISPR GTTTCAGAAAGGCCGTCCTT AGG (reversed) Intronic
902215191 1:14930339-14930361 GTTTCAGAAAAGCTCTCCTGGGG + Intronic
905010489 1:34743625-34743647 GCTTCAGACAGGCCTTCCCTAGG - Intronic
908401868 1:63779060-63779082 GTTTCAGCAAGACCGTCTTAGGG - Intronic
911838268 1:102649052-102649074 GTTTCAGAAAGCCCAGCCATTGG + Intergenic
912603458 1:110963655-110963677 GTTTCAGGAAGACCCTCCGTAGG + Exonic
913189718 1:116403234-116403256 GTGTGAGAAAGGCTGTCCCTGGG - Intronic
917477974 1:175385235-175385257 GTGCCAGAAAGCCTGTCCTTTGG + Intronic
920003646 1:202816588-202816610 GGTTCAGAGAGGCTGTCATTTGG + Intergenic
923910125 1:238431798-238431820 GTTCCAGAAAGGCTGTCTATAGG - Intergenic
1067139390 10:43643932-43643954 CTTTCAGAAAGACCATCATTGGG - Exonic
1068161635 10:53272170-53272192 GTTCCAGAAAGGCTGTCCATAGG - Intergenic
1072779793 10:98240516-98240538 GGTTCTGAAAGGCCATCTTTTGG + Intronic
1073235425 10:102011035-102011057 GATTCAGAAAGTCTGTCTTTCGG - Intronic
1073256021 10:102151892-102151914 GTATCAGAAAGGGCCTCCCTGGG + Intergenic
1074973496 10:118562758-118562780 TTTTCAGAATGACCCTCCTTTGG - Intergenic
1075508653 10:123050164-123050186 GTTTAAGAAAGGCCATTCCTGGG + Intronic
1076737200 10:132464212-132464234 GTGTCAGGGAGGCTGTCCTTAGG - Intergenic
1078687720 11:13548792-13548814 GTTTCAGGAAGGCTGTCTATAGG + Intergenic
1084840347 11:71841154-71841176 GTTTCAGGCAGGCCATCCTTGGG - Intergenic
1087083370 11:94193479-94193501 GCTGCACAAAGGCCATCCTTGGG - Intergenic
1091315381 11:134610658-134610680 GTCTGAGAAAGGCAGTCCTCAGG - Intergenic
1091602801 12:1928241-1928263 GTTTCTGGAATGCTGTCCTTGGG - Intergenic
1092742983 12:11648727-11648749 GTTTCAGAGAAGCGGTCCTGGGG + Intergenic
1097148387 12:56957606-56957628 GTTGCAGAAAGGCAGTCATCAGG - Exonic
1100792706 12:98148114-98148136 GTTTCACAAAGCCAGTTCTTAGG - Intergenic
1101557175 12:105821333-105821355 GTTTCAGAAATGCCTTCAGTGGG + Intergenic
1104633058 12:130420896-130420918 CGCTCAGAAAGGACGTCCTTTGG - Intronic
1106586091 13:31057382-31057404 GTTTCACACACGCTGTCCTTTGG - Intergenic
1108070533 13:46624396-46624418 GTTTCAGAATGGCAGCACTTTGG + Intronic
1114149411 14:20020192-20020214 GTTTCTGAAATGCAGTCATTAGG + Intergenic
1115415792 14:33131993-33132015 GATTGAGAAGGGCTGTCCTTAGG + Intronic
1116030718 14:39567982-39568004 GCTTCAGAATGGCCTTCCTTAGG - Intergenic
1119703227 14:76768955-76768977 GTTTCAGAACAGACTTCCTTGGG - Intronic
1120062565 14:80001416-80001438 GTTTCACAAAGGCCTTACTGAGG - Intergenic
1120616149 14:86707529-86707551 GTTACAGAAAGGCCATACTAGGG - Intergenic
1122505780 14:102230870-102230892 GTTTCAGCAAGTCTGTCTTTCGG + Intronic
1126996234 15:54448426-54448448 GATTCATAAAGGAAGTCCTTAGG - Intronic
1129300979 15:74625320-74625342 GCCACAGAAAGGCCCTCCTTTGG - Intronic
1129971538 15:79781742-79781764 ATTTCAGAAAGCCAGTCTTTAGG - Intergenic
1134137073 16:11684214-11684236 GTCTCAGAATGACCTTCCTTGGG - Exonic
1139667723 16:68469973-68469995 TTTTTAGAAATGCCGTTCTTTGG - Intergenic
1139691466 16:68644774-68644796 AATTCAGAAACGCGGTCCTTCGG + Intronic
1141395299 16:83699154-83699176 GTTTCACAATGCCCGTGCTTTGG - Intronic
1147859959 17:43513538-43513560 GTTTCAGAAAGGCCCTAATCAGG - Intronic
1148259575 17:46168790-46168812 GTTTCCTAAAAGCCATCCTTTGG + Intronic
1151431322 17:74065467-74065489 GTTTCAGAAATGCGGGTCTTGGG - Intergenic
1153339854 18:3962240-3962262 CTTTCAGAAAGGACGTCATCGGG + Intronic
1162097650 19:8320673-8320695 GTTTCAGGAGGGCTGTCCTCCGG + Intronic
1165863352 19:38921207-38921229 GTCTCTGAGAGGCGGTCCTTGGG - Intronic
1166432023 19:42736095-42736117 GTTTTACAAAGGCAGTCCCTGGG - Intronic
1166435140 19:42761302-42761324 GTTTTACAAAGGCAGTCCCTGGG - Intronic
1166445011 19:42851327-42851349 GTTTTAGAAAGGCAGCCCCTGGG - Intronic
1166464689 19:43022080-43022102 GTTTGACAAAGGCAGTCCCTGGG - Intronic
1166470816 19:43078268-43078290 GTTTGACAAAGGCCGTCCCTGGG - Intronic
1166481969 19:43182187-43182209 GTTTGACAAAGGCCATCCCTGGG - Intronic
1166484452 19:43201287-43201309 GTTTGACAAAGGCCGTCCCTGGG - Intronic
928274851 2:29891214-29891236 GTATTAGAAAGGCCTTCCTTTGG + Intronic
928469074 2:31555547-31555569 GTTTCAGAAAGGCCGTCCTTAGG - Intronic
928680396 2:33695466-33695488 CTTTCAGAAATGTCCTCCTTGGG + Intergenic
928857863 2:35821868-35821890 GTTTCAGACAGGGCATACTTCGG - Intergenic
929738937 2:44582155-44582177 GTTTCAGAAAGGCCCGGTTTAGG - Intronic
932580245 2:72988754-72988776 GTTTCAGAAAGATGGTGCTTAGG - Intronic
933086289 2:78058546-78058568 GTTCCAGAAAGGCTGTCTATAGG + Intergenic
938616019 2:132999501-132999523 CTTTCAGAAAGATCTTCCTTTGG - Intronic
939647302 2:144716540-144716562 CTTTCAGAAGGGCTGCCCTTTGG - Intergenic
941059052 2:160825319-160825341 GTCTCAGAAAGGCCCTTTTTGGG + Intergenic
942986196 2:182145305-182145327 GTTTGAGAAAGCCCTGCCTTTGG - Intronic
943479021 2:188395384-188395406 GTTCCAGAAAGGCTGTCCTTTGG + Intronic
946764972 2:223032179-223032201 GTTACAGAATGTCCTTCCTTGGG + Intergenic
947482201 2:230510879-230510901 GTTTCACGAAGGCCTGCCTTGGG + Intronic
1170351992 20:15451829-15451851 GATCCAGTAAGGCCTTCCTTGGG + Intronic
1173410802 20:42808028-42808050 CTCTCAGAAAGGCAGACCTTGGG - Intronic
1183207761 22:36431439-36431461 GTTCCAGGTAGGACGTCCTTGGG - Intergenic
949197578 3:1331384-1331406 TTTACAGAAAGGCTGTTCTTGGG + Intronic
949977541 3:9474788-9474810 GTTACAGAAAGGTATTCCTTGGG - Intronic
953235492 3:41102831-41102853 GGTTCAGAAAGGCCAGCCTCAGG + Intergenic
956317121 3:67950276-67950298 GATTCATAAAGGAAGTCCTTAGG + Intergenic
957677965 3:83394319-83394341 ATTTCAGAAAGGCTGTCTATAGG - Intergenic
957921706 3:86757159-86757181 GTTTCAGGAAGGCTCTCCATAGG + Intergenic
961947212 3:130704104-130704126 GCTTCAGAAAGGCAGCCCCTGGG + Intronic
962201457 3:133403969-133403991 GAATCAGGAAGGCCGTCCTGGGG + Intronic
964168828 3:153742187-153742209 GGTTCATAAAGTCCCTCCTTTGG + Intergenic
966490117 3:180517879-180517901 GTTTCAGAAAGCCAGTCTTCAGG - Intergenic
966770985 3:183503219-183503241 GTTTCAGCAAAGCTGTCCTTGGG + Intronic
969781437 4:9407153-9407175 GTTTCAGGCAGGCCATCCTTGGG - Intergenic
971061790 4:22979427-22979449 GTTCCAGAAAGGCTGTCTATAGG - Intergenic
972909555 4:43797654-43797676 GTTTCAGAAATGCCATCCAAGGG - Intergenic
973836004 4:54809575-54809597 GATTCATAAAGGAAGTCCTTAGG + Intergenic
979664208 4:123293153-123293175 GCTCCAGAAAGGCCATCCATAGG + Intronic
987374659 5:17222408-17222430 GTTTCACAAAAGCCTTCCTTTGG - Intronic
990640291 5:57775935-57775957 TTTTCAGAAAGGACTTGCTTGGG + Intergenic
990892881 5:60666488-60666510 GTCTCAGAAAGCCCATCCTTAGG - Intronic
993570750 5:89535915-89535937 GGTTCAGAAAGGGGGTCCTCTGG - Intergenic
996749713 5:126876240-126876262 ATTTCAGAAAGGCCTTACATTGG + Intronic
998933942 5:147214375-147214397 ATTTCAGGATGGCCATCCTTTGG - Intergenic
999127306 5:149255106-149255128 GGTTCAGCAAGGCTGTCATTTGG + Intronic
999191448 5:149750568-149750590 GGTTCAGAATGGCCATTCTTGGG + Intronic
1001439295 5:171726970-171726992 GTTTCAGCAAGGCATTACTTTGG - Intergenic
1003475410 6:6477627-6477649 GTTTCAGAGTGGCCGTGCTAAGG - Intergenic
1006807562 6:36798397-36798419 GTTTCTGAAATGCCATCCTCTGG - Intronic
1008956970 6:57226303-57226325 GTATCAGAAAGGCCTTCCCTTGG - Intergenic
1013495116 6:110690171-110690193 GTTCCAGAAAGGCTGTCTATAGG - Intronic
1014749930 6:125244652-125244674 GTTCCAGAAAGGCTGTCTATAGG + Intronic
1015974746 6:138778526-138778548 GTTCCAAAAAGGCCTTCCTGAGG + Intronic
1017799356 6:157878703-157878725 GTCTCAGAAAGGGCTTCCATAGG - Intronic
1018209439 6:161466732-161466754 TTGTCAGAAAGCCTGTCCTTGGG - Intronic
1018330593 6:162723523-162723545 GTCTCAGGAAGGACGTCTTTTGG + Intronic
1019462726 7:1169629-1169651 GCATCAGAAATGCCATCCTTGGG + Intergenic
1027008124 7:74714850-74714872 GTTTCAGAAGGGCCTGCTTTGGG - Intronic
1031943467 7:127814187-127814209 GTTTCTGAAATGTCGTCCTTGGG + Intronic
1032331659 7:130986339-130986361 GTTTCATCAAGGACTTCCTTTGG - Intergenic
1033347951 7:140540125-140540147 GTGTGAGAAAGACCGTCATTGGG - Intronic
1033582977 7:142753287-142753309 GTTTCAGAAAGGTGGTCTTTGGG + Intronic
1035302384 7:157906072-157906094 GTTTCAGGAAGGCTGACCTCAGG - Intronic
1036837997 8:12091579-12091601 GTTTCAGGCAGGCCATCCTTGGG + Intergenic
1036859787 8:12337826-12337848 GTTTCAGGCAGGCCATCCTTGGG + Intergenic
1037613152 8:20493523-20493545 GTTTCAGAAAAGCTCTCCTGGGG + Intergenic
1040362736 8:46683221-46683243 GTTTCAGGAAGGCTGTCTATAGG + Intergenic
1042516520 8:69664483-69664505 GTTTTAGACATGACGTCCTTGGG - Intergenic
1042557726 8:70047542-70047564 GATTCAGAAAGGACATCCTGAGG + Intergenic
1044880159 8:96715493-96715515 ATTTCAGAAAGGCTGTCTATAGG + Intronic
1044892844 8:96855547-96855569 GTATCAGAAAGGCCTCCCTGGGG - Intronic
1047384219 8:124394721-124394743 GTTCCAGAAAGGCTGTCTGTAGG + Intergenic
1047643605 8:126846674-126846696 GGTTCAGAAAGGTAGTCATTAGG - Intergenic
1049755293 8:144308817-144308839 GTTTCAGAAGGGGCGGCCTGGGG + Intronic
1052901756 9:33799444-33799466 GTTTCAGAAAGGTGGTCTTTGGG + Intergenic
1053396002 9:37774990-37775012 GTTTCTGAATGGCCATCTTTTGG + Intronic
1053655105 9:40210765-40210787 GTTTCAGAAGGGCCTGCTTTGGG - Intergenic
1053905487 9:42839977-42839999 GTTTCAGAAGGGCCTTCTTTGGG - Intergenic
1054367220 9:64356981-64357003 GTTTCAGAAGGGCCTGCTTTGGG - Intergenic
1054529494 9:66165549-66165571 GTTTCAGAAGGGCCTGCTTTGGG + Intergenic
1054674851 9:67846718-67846740 GTTTCAGAAGGGCCTGCTTTGGG - Intergenic
1055668016 9:78571392-78571414 GTTTCAGAAAGGACTTCTTCCGG - Intergenic
1056501788 9:87216917-87216939 CTTTCTGAGAGGCCTTCCTTAGG - Intergenic
1059834022 9:118129621-118129643 GTTCCAGAAAGGCTGTCTATAGG - Intergenic
1060340276 9:122769009-122769031 GTTTCAGAAAGACAGTCTTCAGG - Intergenic
1185940990 X:4318833-4318855 GTTTCATAAAGGACTTCCTTAGG - Intergenic
1186974714 X:14889284-14889306 ATTTCAGAAAACCAGTCCTTGGG - Intronic
1190036285 X:47028131-47028153 GCTTCAGAAAGGCTGACCGTAGG - Intronic
1192981735 X:76351382-76351404 ATTTCAGAAAGGCTGTCTATAGG - Intergenic
1193994346 X:88345945-88345967 GTTCCAGAAAGGCTGTCAATAGG - Intergenic
1196977743 X:121179120-121179142 GTTCCAGAAAGGCTGTCTATAGG + Intergenic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic
1201726535 Y:17158157-17158179 ATTTCACAAAGGATGTCCTTAGG - Intergenic