ID: 928470714

View in Genome Browser
Species Human (GRCh38)
Location 2:31573090-31573112
Sequence TGGCCTGTTCCCAGATTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 264}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928470714_928470717 -7 Left 928470714 2:31573090-31573112 CCCAGAAATCTGGGAACAGGCCA 0: 1
1: 0
2: 1
3: 13
4: 264
Right 928470717 2:31573106-31573128 CAGGCCATTCTTCAAGGACCAGG 0: 1
1: 0
2: 2
3: 28
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928470714 Original CRISPR TGGCCTGTTCCCAGATTTCT GGG (reversed) Intronic
900727849 1:4230055-4230077 AGGCCTGTCCCCTGGTTTCTGGG + Intergenic
901810421 1:11764215-11764237 TGGCCTGGTCCCAGCTGCCTGGG - Intronic
903570144 1:24298110-24298132 TGCCCTGGTCCCAGACTGCTGGG - Intergenic
904719183 1:32493901-32493923 TGGCATGTATCCTGATTTCTGGG - Exonic
909707143 1:78598953-78598975 TGGGCTGGTCCCGAATTTCTTGG + Intergenic
912713944 1:111968749-111968771 AAGCCAGTTCCCACATTTCTGGG - Intronic
913401817 1:118443463-118443485 TTGTCTGTTTACAGATTTCTAGG - Intergenic
917136066 1:171789121-171789143 TGTCATGTTCCTTGATTTCTTGG + Intronic
917220873 1:172727451-172727473 TGGCCTGGTTCCAATTTTCTAGG + Intergenic
918945732 1:191061945-191061967 TGGTCTTTTCACATATTTCTTGG + Intergenic
919018936 1:192078040-192078062 TGGCCTTTTCCCTGATTTCTGGG - Intergenic
919606542 1:199690962-199690984 TGTCTTGTCCCCAGGTTTCTAGG + Intergenic
919835565 1:201570780-201570802 AGGCCTGTTCCCAGAAGTCCAGG + Intergenic
919838705 1:201594039-201594061 TTGCCTGCTGCCAGACTTCTTGG - Intergenic
921303874 1:213776248-213776270 TGGACTTTTCCCAGATCTGTCGG + Intergenic
1064586618 10:16845535-16845557 TGGCTTTTTCCCAGACATCTGGG - Intronic
1067249565 10:44575454-44575476 GGGCCTCTTTGCAGATTTCTGGG - Intergenic
1068413317 10:56685282-56685304 TCACCTATTCCCATATTTCTTGG - Intergenic
1068741672 10:60480427-60480449 TTGAATGTTCCCAGATCTCTGGG - Intronic
1069758727 10:70792623-70792645 TGGCTTGTTTGAAGATTTCTTGG + Intergenic
1070313774 10:75292746-75292768 TTGCCTGTTCCCTGAGGTCTAGG - Intergenic
1070809211 10:79289207-79289229 AGGCCTGTACCCACATTGCTGGG + Intronic
1071249307 10:83800786-83800808 AGGCCTATTCTCAGAGTTCTTGG + Intergenic
1071982220 10:91014757-91014779 AGGCCTGTTCCCAGCATTTTGGG + Intergenic
1075881951 10:125860617-125860639 TGGGCTTTTCCCATACTTCTTGG + Intronic
1077738008 11:4812010-4812032 TGGAATGTACCAAGATTTCTGGG + Intronic
1077868175 11:6240061-6240083 TGCCCTGTTCCAAGAATCCTGGG - Exonic
1078400867 11:11025766-11025788 TGGTCTGTTCTCAGATTTACTGG + Intergenic
1078422123 11:11221129-11221151 GGTCCTGCTACCAGATTTCTTGG + Intergenic
1078651901 11:13203310-13203332 TGGCCTGTTTTCATTTTTCTTGG - Intergenic
1079135616 11:17774664-17774686 TGCCCTGGTCCCAGGTTTCAGGG + Intronic
1079385868 11:19979132-19979154 TGGCCAGCTCCCAGAGGTCTGGG + Intronic
1080196576 11:29616909-29616931 TTGCCTGTTCCCATTTTTCAGGG + Intergenic
1081407358 11:42713479-42713501 AGGGCTGTACCCAGATTTATGGG - Intergenic
1081630028 11:44682958-44682980 TTGCCTGTTTCCAGATTTTATGG + Intergenic
1081684460 11:45032439-45032461 TGGCCTCTTCCTACATTTCTGGG + Intergenic
1082988145 11:59185419-59185441 TGGCCTGTTCCCTGATATGGAGG - Intronic
1085259468 11:75195944-75195966 GGGCCTGTTCCCAAATCCCTGGG - Intronic
1091190998 11:133695188-133695210 TGTCATGTTCTCAGATTTCCTGG - Intergenic
1091636745 12:2202964-2202986 TGGCCAGCTCCTAGGTTTCTAGG - Intronic
1091700040 12:2653076-2653098 TGGCCTGTCCCCAGAAGTCACGG + Intronic
1094027088 12:25970268-25970290 TGCTCTGTGCCCTGATTTCTGGG + Intronic
1094723500 12:33089252-33089274 TGTCTTGTGCCCAGACTTCTAGG + Intergenic
1097056530 12:56253362-56253384 TGGCGTGTTCCCAAATTTGTCGG + Exonic
1097098116 12:56566117-56566139 TGTTCTGTTCCCAGCTTTCAGGG + Intronic
1097140126 12:56895328-56895350 TGGCCTCCTCCCAGAGTGCTTGG + Intergenic
1098364583 12:69689165-69689187 TTGCCTGTGCCAAGGTTTCTGGG - Intronic
1101118177 12:101552364-101552386 TGCCCTGCCCCCAGATTTGTAGG - Intergenic
1101752333 12:107592169-107592191 GGGACTGTTCACATATTTCTTGG - Intronic
1101952352 12:109186808-109186830 TGGCTCGTTCCCAGGTTCCTAGG + Intronic
1103964138 12:124627358-124627380 TGGCCTGTTGCCTGGTTTGTAGG + Intergenic
1104014851 12:124955071-124955093 TGGCCTCTGCCCAGATCTCCTGG - Intronic
1104492804 12:129209240-129209262 TGGCCTCTTCCCAGATCCCCAGG - Intronic
1104984079 12:132586938-132586960 AGGTATGTTCCCAGATCTCTGGG - Intergenic
1105239662 13:18598312-18598334 TTGCCTGCACCCAGAGTTCTGGG + Intergenic
1105266268 13:18820003-18820025 TGGCTTGTACCCAGAGTTCAGGG + Intergenic
1107836552 13:44416377-44416399 GGGCCTGTGCCCAGACTCCTTGG - Intergenic
1108508119 13:51131509-51131531 AGGCCTTTTCCCAGATAACTTGG - Intergenic
1115478850 14:33842053-33842075 TGGGCTGTTCCCAGATGGCATGG + Intergenic
1117668621 14:58082760-58082782 TGGAGTTTTCCCAGTTTTCTGGG + Intronic
1118498600 14:66334230-66334252 TGGTCTTTTCCCACACTTCTTGG - Intergenic
1119183317 14:72618886-72618908 GGGGCTGTGCCAAGATTTCTTGG + Intergenic
1119778178 14:77260890-77260912 TGGCCAGATTCCAGGTTTCTAGG + Intergenic
1121329148 14:93039168-93039190 AGGCCTGTGCCCAGAACTCTGGG - Intronic
1202832253 14_GL000009v2_random:48080-48102 TGGCTTGTACCCAGAGTTCAGGG - Intergenic
1126381588 15:48053215-48053237 TGGCTTGTTCCCAGTCTCCTGGG - Intergenic
1128800710 15:70495049-70495071 TAGCCTCTCCCCAGCTTTCTGGG - Intergenic
1130274903 15:82471322-82471344 TAGCCTCTTCCCAGCTTTCCTGG - Intergenic
1130589547 15:85203289-85203311 TAGCCTCTTCCCAGCTTTCCTGG - Intergenic
1130884767 15:88083712-88083734 TGGCCTGTTCCCCCATTTGAAGG + Intronic
1131622647 15:94083631-94083653 TGTCATGTTCCCAGACTTTTAGG - Intergenic
1131833850 15:96370905-96370927 TGGCCTGTTCCTAGCTGCCTAGG - Intergenic
1131833888 15:96371140-96371162 TGGCCTGTTCCTAGCTGGCTGGG - Intergenic
1132033522 15:98458951-98458973 TGGCATAATCCCAGACTTCTTGG - Intronic
1132067567 15:98744656-98744678 TGGCCTGTCCTCAGACCTCTGGG - Intronic
1132101900 15:99029568-99029590 TGTCCTGCTCCCAAGTTTCTTGG - Intergenic
1137744827 16:50812854-50812876 TGGCCTCCTCCCATATTTGTCGG + Intergenic
1143003499 17:3811164-3811186 TGGGCTGTTACCAGAATTCCTGG - Intergenic
1144732714 17:17537756-17537778 TGACCTGTGCCTAGATTTCCCGG + Intronic
1144832543 17:18139765-18139787 TGGCCTGTTCCCACCTAGCTTGG + Intronic
1145097541 17:20043633-20043655 TGGGCAGTTCCTTGATTTCTGGG + Intronic
1145912467 17:28550616-28550638 TTTGCTGTTCCCAGATTACTGGG - Intronic
1146469442 17:33112141-33112163 TGACCTGCTGTCAGATTTCTGGG - Intronic
1147356336 17:39900741-39900763 GGCCCTGTTCCTAGTTTTCTTGG + Intergenic
1150227405 17:63531468-63531490 GGGCCTGCTCCCAGCTTTCCTGG + Intronic
1150659284 17:67061478-67061500 TGGCCTCTGCCCAGGTTCCTGGG + Intergenic
1152589538 17:81204574-81204596 TGGTCTTTGCCCAGATGTCTTGG - Intronic
1152989071 18:346028-346050 TGGCCTGTTCACATAGCTCTTGG - Intronic
1153028183 18:689871-689893 TAGCCTATTCCCAGATAGCTGGG + Intronic
1153211145 18:2766288-2766310 CGGCCTGTCTCCAGTTTTCTTGG + Intronic
1153873947 18:9348469-9348491 TTGCCTGTGCACAGTTTTCTGGG + Intronic
1154449167 18:14460462-14460484 TTGCCTGCACCCAGAGTTCTGGG - Intergenic
1155355223 18:24945338-24945360 TGGCCTGTTACCAGATTCTGAGG + Intergenic
1157770272 18:50339569-50339591 TGGCCTGCTCCCTGTTTTCAAGG - Intergenic
1158162178 18:54497357-54497379 TGGAGTGTTCCCACATTTGTGGG + Intergenic
1162902784 19:13805319-13805341 TGTCCTGTGTCCAGATATCTGGG - Intronic
1163518445 19:17778712-17778734 TGGCCCCTCCCCAGATTCCTGGG + Exonic
1164295138 19:23903314-23903336 TCACTTGTTCCCAGAGTTCTAGG - Intergenic
1164948367 19:32315284-32315306 TGGGCTGGTCTCAGACTTCTGGG - Intergenic
1165450169 19:35877851-35877873 GGGCCTGTTCCCTAATGTCTGGG - Intronic
1167607167 19:50487630-50487652 TTGCCTGCTCCCAGGTTTCCAGG - Exonic
1168596442 19:57681715-57681737 GGGGCTTTTCCCAGATTTCTGGG - Intergenic
1202640430 1_KI270706v1_random:79691-79713 TGGCTTGTACCCAGAGTTCAGGG + Intergenic
925671421 2:6313847-6313869 TGTCCTGTGGCCAGTTTTCTCGG - Intergenic
928470714 2:31573090-31573112 TGGCCTGTTCCCAGATTTCTGGG - Intronic
929457832 2:42078490-42078512 AGGCCGGTGCCCAGAGTTCTGGG - Intergenic
929997676 2:46839129-46839151 TGGCCTGTTCTCATATCACTTGG - Intronic
931358657 2:61559192-61559214 TGGGCTGTTCTCAAATTCCTGGG - Intergenic
932553489 2:72796710-72796732 TGGCGTGTGCCAAGATTTATGGG - Intronic
933748285 2:85586277-85586299 TGGCCTTTTCCCAGTTTTATAGG - Intronic
934495988 2:94799661-94799683 TGGCTTGTACCCAGAGTTCAGGG + Intergenic
934748668 2:96777314-96777336 CGGCCTGTTGCCTGTTTTCTAGG + Intronic
935784182 2:106533909-106533931 TGGCCAATTCCCAGGCTTCTTGG + Intergenic
937433332 2:121859563-121859585 TTGCCTGTTTCCTGGTTTCTTGG + Intergenic
937633563 2:124130334-124130356 TGCCCTGTTGCCAAATCTCTGGG + Intronic
938242611 2:129755014-129755036 TGGCCTCTCCCCAGATGCCTGGG + Intergenic
938773645 2:134522172-134522194 TGTCCTGTTCTTAGACTTCTGGG - Intronic
938968541 2:136409549-136409571 TGGCCTCTTCCCAAAGTGCTGGG + Intergenic
942969554 2:181941501-181941523 AGGCCTCTTCCCAGGCTTCTTGG - Intergenic
943015619 2:182506743-182506765 GGCCCAGTTCCCAGTTTTCTAGG - Intronic
943865805 2:192923437-192923459 TGTCCTGTACCCAGACTCCTAGG - Intergenic
944636874 2:201683082-201683104 TGGACTGTTCACACATTTCTGGG - Intronic
946053284 2:216881216-216881238 TGGCCAGCTCCAAGATTTATTGG + Intergenic
946143546 2:217712005-217712027 TGTACTGTTCCCAGAAATCTGGG - Intronic
948161453 2:235828114-235828136 TGGCTTGTTCTCATGTTTCTGGG + Intronic
1171423142 20:25032331-25032353 TCGCCTGCTCCCAGTTTTCCCGG - Intronic
1172035390 20:32007120-32007142 TGGCCTGATACCAGAGTTCTTGG + Intergenic
1174506436 20:51020674-51020696 TTGCCTGTTGCCAGAGGTCTAGG - Intronic
1174996485 20:55574487-55574509 TGGCCTGATCACATTTTTCTTGG + Intergenic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
1176268610 20:64223697-64223719 TGGGCTTTTCCCAAATCTCTAGG - Intronic
1176447034 21:6830040-6830062 TTGCCTGCTCCCAGAGTTCCGGG + Intergenic
1176825205 21:13695066-13695088 TTGCCTGCTCCCAGAGTTCCGGG + Intergenic
1177021136 21:15859605-15859627 TTTCGTGTTACCAGATTTCTAGG + Intronic
1177942521 21:27428838-27428860 TTCCCTTGTCCCAGATTTCTTGG - Intergenic
1178363773 21:31971370-31971392 TGGCCTGGAACCAGAATTCTAGG + Intronic
1178889657 21:36510467-36510489 TGGCTTGTGTCCAGATCTCTGGG + Intronic
1179480960 21:41678364-41678386 TTGCCAGCTCCCAGATTTCCAGG - Intergenic
1179507875 21:41853807-41853829 TGGCCTCCTCCCAGATTTGGGGG - Intronic
1179589610 21:42397834-42397856 TTCCCTGTTCCCTGCTTTCTAGG - Intergenic
1180361513 22:11902189-11902211 TGGCTTGTACCCAGAGTTCAGGG - Intergenic
1180746905 22:18095584-18095606 TGTCCTGTTCCTGGATTTCATGG + Exonic
949608002 3:5675556-5675578 TGGCAGGTTCCCAGAAATCTTGG + Intergenic
950935690 3:16836635-16836657 TGGCCTTTTCCCTGATTTCAGGG - Intronic
955103127 3:55871181-55871203 TGGCTTAGTCCCAGCTTTCTGGG - Intronic
955276121 3:57549053-57549075 TGGCCTGTGCCCATAATTCCAGG + Intergenic
955543029 3:59998352-59998374 TGGCATGTTCATAGATTCCTGGG - Intronic
956067523 3:65412737-65412759 TGGTCTGTTCCTTGATTTATTGG + Intronic
961105589 3:124238282-124238304 ATGCCTGTTCCCTCATTTCTGGG - Intronic
961696063 3:128705786-128705808 TGGCCTGTTCCCAGCTTTAAAGG + Intergenic
962009919 3:131382422-131382444 TGCCCTCTCCCCAGCTTTCTTGG + Exonic
963866865 3:150370711-150370733 TGGCAAGTTACCTGATTTCTTGG + Intergenic
965200934 3:165656630-165656652 TGGTCTTTTCACATATTTCTTGG - Intergenic
966477699 3:180368840-180368862 TCGCATATTCCCATATTTCTTGG - Intergenic
966591443 3:181687896-181687918 TGGCCTGTGGCCTGATTTCCTGG + Intergenic
1202738124 3_GL000221v1_random:27710-27732 TGGCTTGTACCCAGAGTTCAGGG - Intergenic
969926213 4:10588021-10588043 TGGCCTCTTCTCTGATGTCTTGG + Intronic
969947183 4:10795984-10796006 TAGCATAATCCCAGATTTCTTGG + Intergenic
971441596 4:26693481-26693503 TGGGCTGGTCCCAAATTCCTGGG - Intronic
971494777 4:27252092-27252114 TGGCCTGTAATCAGATATCTGGG - Intergenic
971629732 4:28974876-28974898 TAGCATGTTACCAGATATCTGGG + Intergenic
972303407 4:37807648-37807670 TGGGCTGGTCTCACATTTCTGGG + Intergenic
972458087 4:39273517-39273539 TGGCATGTGCCCAGTTTTCCAGG + Intronic
973275456 4:48302198-48302220 TGGACTGGGCACAGATTTCTTGG + Intergenic
973383945 4:49490202-49490224 TGGCTTGTACCCAGAGTTCAGGG + Intergenic
974188207 4:58467189-58467211 TGGCCTGTCCAGAGATTTCAGGG + Intergenic
978333789 4:107644436-107644458 TGTCCCGTTACCAGAGTTCTAGG - Intronic
978448809 4:108806729-108806751 TGGGCTGGTCTCAAATTTCTGGG + Intergenic
978455416 4:108884403-108884425 TGACCTCTTCACAGATTTTTTGG + Intronic
983786608 4:171739494-171739516 TGGCATATTTTCAGATTTCTAGG + Intergenic
984171659 4:176367676-176367698 TGCCCTTTTCCCCCATTTCTAGG + Intergenic
984518258 4:180769064-180769086 TGGCCTATACTCAGATTGCTAGG + Intergenic
984817969 4:183856138-183856160 TAGGCTGGTCACAGATTTCTAGG + Intronic
1202767794 4_GL000008v2_random:165533-165555 TGGCTTGTACCCAGAGTTCAGGG + Intergenic
986126199 5:4884393-4884415 TGGCCTTTTCATAGATTGCTGGG - Intergenic
994970899 5:106735396-106735418 TGGTGTGTTGCCATATTTCTGGG - Intergenic
996413470 5:123183902-123183924 TGGCCTGTTCTCAGTTTCCCAGG - Intronic
997261295 5:132467271-132467293 TGGCCTGGTCCCAGCTTGCCAGG + Intronic
1001554963 5:172630946-172630968 TGGCCTCTTTTCAGATTTATGGG - Intergenic
1003998394 6:11567323-11567345 TGGCCTATTCCCATATGTCAGGG + Intronic
1005952795 6:30643817-30643839 TGATCTGTTGCCAGACTTCTTGG + Intronic
1006187949 6:32191175-32191197 TCGCCTGTTCCCAGAGTTTGAGG + Exonic
1006518598 6:34558409-34558431 TGTCATGTGCCAAGATTTCTAGG + Intergenic
1008263838 6:49399621-49399643 TGTGCTGTTCCAAGATCTCTCGG + Intergenic
1008634436 6:53395748-53395770 TGGTCTGTTCCCAAATCCCTTGG - Intergenic
1010586027 6:77659426-77659448 TGTCTTGTACCCAGATTCCTAGG + Intergenic
1010707634 6:79134079-79134101 TAACCTAATCCCAGATTTCTTGG + Intergenic
1011348790 6:86400100-86400122 AGGCCTTTTCCCCGTTTTCTTGG + Intergenic
1012482245 6:99680115-99680137 TGTCCTGTTCCAAATTTTCTAGG - Intergenic
1015663178 6:135599406-135599428 TAGCATAATCCCAGATTTCTTGG + Intergenic
1016322707 6:142864296-142864318 TAGGCTGTTCCTAGAATTCTTGG - Intronic
1016361008 6:143267472-143267494 TGGCCAGTTCCTGGATTACTGGG - Intronic
1017636070 6:156444325-156444347 GAGCCTGTTCCCAGGATTCTAGG - Intergenic
1018905454 6:168073083-168073105 TGGACTTTTCCCAGTTTTCAGGG - Intronic
1018987805 6:168650814-168650836 TGGCAGGGTCCCAGAATTCTGGG + Intronic
1019390755 7:785536-785558 CGGGCTGTTCCCAGATCTCCTGG + Exonic
1021728429 7:23572849-23572871 TGGGCTGGTCCCAAATTCCTGGG - Intergenic
1023883324 7:44334048-44334070 TGGGTTGTTTCCAGTTTTCTTGG - Intronic
1024656008 7:51451860-51451882 GGACCTGTTCAAAGATTTCTGGG + Intergenic
1026030017 7:66783787-66783809 TGGTCTGTTTATAGATTTCTTGG - Exonic
1027201652 7:76067758-76067780 TGGCCTTTTCCCCGAGGTCTTGG + Intergenic
1027207907 7:76117755-76117777 TGGTCTGTTTATAGATTTCTTGG + Intergenic
1028627819 7:92897403-92897425 TGGTCTTTTCACATATTTCTTGG + Intergenic
1029115904 7:98236943-98236965 GGGCCTGCGCCCAGATTCCTCGG - Intronic
1030839538 7:114331505-114331527 TGACCAGTTCACATATTTCTTGG - Intronic
1031311736 7:120207327-120207349 TGGCCTGGTCCCAGCCTTCCTGG + Intergenic
1031998712 7:128250296-128250318 TTGCCTTTTCCCAAATTACTTGG + Intronic
1032328006 7:130950402-130950424 TGTCCTGTACCCAGATTGATGGG - Intergenic
1035126440 7:156611330-156611352 TGGTCTGCTCACTGATTTCTTGG + Intergenic
1035225363 7:157429612-157429634 TGGCCTGCTGCCAGCTTCCTGGG + Intergenic
1037114761 8:15210946-15210968 TGGATTGATCCAAGATTTCTAGG - Intronic
1037545589 8:19916968-19916990 TGGTCTTTTCACATATTTCTTGG + Intronic
1038574779 8:28695677-28695699 TGACCTGTTCCCACAATTCCAGG + Intronic
1038654352 8:29435667-29435689 CTGCCTGTGCCCAGATTTCATGG - Intergenic
1039463045 8:37762266-37762288 TTGCCCGTTCCCGGCTTTCTGGG - Intergenic
1040817286 8:51521491-51521513 TGCCATTTTCCCACATTTCTTGG - Intronic
1041412394 8:57571285-57571307 TTGACTGTTACCAGATTTTTAGG + Intergenic
1042281564 8:67061948-67061970 TGGCCAGTTCCCAGGTTTTCTGG + Exonic
1042725213 8:71867977-71867999 TTGTCTCTTCCCAGATTTCAGGG - Intronic
1045256356 8:100526934-100526956 TAGCCTCTTCCCAGTATTCTCGG - Intronic
1045590842 8:103594889-103594911 TGAACTGTTCCCAGGTTTCATGG - Intronic
1045798358 8:106072907-106072929 TAGGCTGTTCTCAAATTTCTGGG - Intergenic
1046471626 8:114682545-114682567 TGGCCTTTACCTAGATTTCAAGG - Intergenic
1048078029 8:131094578-131094600 TGGACAGTTCCTAGATTTTTGGG + Intergenic
1049110055 8:140636515-140636537 TCGCCTTTTCCCAGATTTCCCGG + Intergenic
1049631435 8:143660390-143660412 TGGCCTCCTCCCAGACTACTGGG + Intergenic
1052337972 9:27338822-27338844 TGGCCTTTTCCCAAATGCCTTGG + Intronic
1052563912 9:30122066-30122088 TGGTGTGTTCTCAGATTCCTGGG + Intergenic
1052876080 9:33565546-33565568 TGGCTTGTACCCAGAGTTCAGGG - Intronic
1053499929 9:38578797-38578819 TGGCTTGTACCCAGAGTTCAGGG + Intergenic
1053661156 9:40280724-40280746 TGGCTTGTACCCAGAGTTCAGGG - Intronic
1053911530 9:42910061-42910083 TGGCTTGTACCCAGAGTTCAGGG - Intergenic
1054373273 9:64426939-64426961 TGGCTTGTACCCAGAGTTCAGGG - Intergenic
1054523454 9:66095560-66095582 TGGCTTGTACCCAGAGTTCAGGG + Intergenic
1054680906 9:67916717-67916739 TGGCTTGTACCCAGAGTTCAGGG - Intergenic
1055609564 9:78007757-78007779 AGCCCTGTTCCCAGATGTGTGGG - Intronic
1056821769 9:89847306-89847328 TGGCCTTTTCCCACATTCCTTGG - Intergenic
1057394011 9:94663415-94663437 TGGCCTGGAACCACATTTCTCGG - Intergenic
1057679351 9:97163495-97163517 TGGCTTGTACCCAGAGTTCAGGG + Intergenic
1060245075 9:121938682-121938704 TGGCCTTTTCATAGATTTATTGG - Intronic
1061539578 9:131270772-131270794 TGGCCTGTCCCCAGATCTGCTGG + Intronic
1061552257 9:131344039-131344061 TCACCTGGTCCCATATTTCTTGG + Intergenic
1203522156 Un_GL000213v1:54491-54513 TTGCCTGCTCCCAGAGTTCCGGG - Intergenic
1203692206 Un_GL000214v1:54455-54477 TGGCTTGTACCCAGAGTTCAGGG + Intergenic
1203706853 Un_KI270742v1:58154-58176 TGGCTTGTACCCAGAGTTCAGGG - Intergenic
1203548552 Un_KI270743v1:150359-150381 TGGCTTGTACCCAGAGTTCAGGG + Intergenic
1203556394 Un_KI270744v1:1348-1370 TGGCTTGTACCCAGAGTTCAGGG + Intergenic
1203644089 Un_KI270751v1:49736-49758 TGGCTTGTACCCAGAGTTCAGGG - Intergenic
1185941235 X:4321886-4321908 TGGCTTCTTCTCAGATTCCTGGG + Intergenic
1186550526 X:10500333-10500355 GATCCTGTTCCCAAATTTCTAGG - Intronic
1187560330 X:20396869-20396891 TTACCTGTCTCCAGATTTCTGGG - Intergenic
1188470634 X:30534313-30534335 TGGCCTGTTGACATATTTCTTGG - Intergenic
1189737560 X:44087239-44087261 TTGCCTGCTACCAGCTTTCTTGG - Intergenic
1190277225 X:48906597-48906619 AGGCCTGTTCCCAGCCTTCAGGG - Intronic
1190455853 X:50627423-50627445 TGGTCTGTACCCAGCTATCTAGG + Intronic
1191012320 X:55773558-55773580 TGACATCTTCCCATATTTCTTGG + Intergenic
1191214238 X:57919298-57919320 TGGTGAGTTCCAAGATTTCTGGG - Intergenic
1193041813 X:77011933-77011955 TGTCCTGTACTCAGATTTGTGGG - Intergenic
1193486500 X:82090581-82090603 TGGCCTCTTCCCAGTGCTCTTGG - Intergenic
1194083405 X:89497154-89497176 TGTCCTGCTGCCAGATTTGTTGG + Intergenic
1195009496 X:100721688-100721710 ATTCCTGTTCTCAGATTTCTTGG + Intronic
1195275212 X:103275002-103275024 TAGCCAGTTCTCAGATTTCAGGG + Intronic
1195629853 X:107043446-107043468 TTGCATGTGCCCAGATTTCTTGG - Intergenic
1195918211 X:109956577-109956599 TAGACTGTTGCCAGATTTCCTGG - Intergenic
1196455929 X:115891623-115891645 TGCCCTGTTCCCTGATCTCTAGG + Intergenic
1197036381 X:121878833-121878855 TCGCATGGTCCCATATTTCTTGG - Intergenic
1197354161 X:125415345-125415367 TGACTTGTTCCCACATTTATGGG + Intergenic
1197478132 X:126948267-126948289 TCACATGTTCCCATATTTCTTGG - Intergenic
1197796531 X:130304830-130304852 TGGCGAGTTCTCAGGTTTCTGGG + Intergenic
1198569285 X:137938106-137938128 AGGCCTTTTCCCTGTTTTCTTGG + Intergenic
1199369625 X:147032092-147032114 TGTTCTTTTCCCAGGTTTCTTGG - Intergenic
1199375727 X:147106643-147106665 TGGCTTCCTACCAGATTTCTAGG + Intergenic
1199468360 X:148165743-148165765 TGGCCTGGTCCCAGTGTTCAGGG - Intergenic
1199915375 X:152334601-152334623 CAGCCTGTTCTCAAATTTCTGGG + Intronic
1200436057 Y:3153033-3153055 TGTCCTGCTGCCAGATTTGTTGG + Intergenic
1201233625 Y:11889805-11889827 TGTCTTGTACCCAGACTTCTAGG + Intergenic
1201520946 Y:14873053-14873075 AGGCCAGTTCACTGATTTCTTGG - Intergenic
1201854167 Y:18522463-18522485 TGACATGGTCCCATATTTCTTGG - Intergenic
1201879154 Y:18797921-18797943 TGACATGGTCCCATATTTCTTGG + Intronic