ID: 928472966 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:31592237-31592259 |
Sequence | CTGTAATGGCTTGAGTTGGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
928472966_928472971 | 8 | Left | 928472966 | 2:31592237-31592259 | CCATCCAACTCAAGCCATTACAG | No data | ||
Right | 928472971 | 2:31592268-31592290 | AACAGAACAAACCTGATCCTAGG | No data | ||||
928472966_928472972 | 12 | Left | 928472966 | 2:31592237-31592259 | CCATCCAACTCAAGCCATTACAG | No data | ||
Right | 928472972 | 2:31592272-31592294 | GAACAAACCTGATCCTAGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
928472966 | Original CRISPR | CTGTAATGGCTTGAGTTGGA TGG (reversed) | Intergenic | ||
No off target data available for this crispr |