ID: 928472966

View in Genome Browser
Species Human (GRCh38)
Location 2:31592237-31592259
Sequence CTGTAATGGCTTGAGTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928472966_928472971 8 Left 928472966 2:31592237-31592259 CCATCCAACTCAAGCCATTACAG No data
Right 928472971 2:31592268-31592290 AACAGAACAAACCTGATCCTAGG No data
928472966_928472972 12 Left 928472966 2:31592237-31592259 CCATCCAACTCAAGCCATTACAG No data
Right 928472972 2:31592272-31592294 GAACAAACCTGATCCTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928472966 Original CRISPR CTGTAATGGCTTGAGTTGGA TGG (reversed) Intergenic
No off target data available for this crispr