ID: 928474437

View in Genome Browser
Species Human (GRCh38)
Location 2:31611985-31612007
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928474434_928474437 11 Left 928474434 2:31611951-31611973 CCATACAATGAAATACAACTTAA No data
Right 928474437 2:31611985-31612007 AAGGATAAACTGGCTGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr