ID: 928475298

View in Genome Browser
Species Human (GRCh38)
Location 2:31620154-31620176
Sequence CTCAGTAAACTATATATTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928475296_928475298 -5 Left 928475296 2:31620136-31620158 CCCTTCATGTTAAAAACTCTCAG 0: 39
1: 938
2: 7874
3: 4304
4: 3210
Right 928475298 2:31620154-31620176 CTCAGTAAACTATATATTGAAGG No data
928475297_928475298 -6 Left 928475297 2:31620137-31620159 CCTTCATGTTAAAAACTCTCAGT 0: 37
1: 856
2: 7600
3: 3401
4: 2264
Right 928475298 2:31620154-31620176 CTCAGTAAACTATATATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928475298 Original CRISPR CTCAGTAAACTATATATTGA AGG Intergenic
No off target data available for this crispr