ID: 928476964

View in Genome Browser
Species Human (GRCh38)
Location 2:31637447-31637469
Sequence ATTTATAAACTGTTGCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928476964_928476968 -5 Left 928476964 2:31637447-31637469 CCCACCAGCAACAGTTTATAAAT No data
Right 928476968 2:31637465-31637487 TAAATGTCATGGCAACAACCTGG No data
928476964_928476969 11 Left 928476964 2:31637447-31637469 CCCACCAGCAACAGTTTATAAAT No data
Right 928476969 2:31637481-31637503 AACCTGGAAGTCAATTTATATGG No data
928476964_928476971 18 Left 928476964 2:31637447-31637469 CCCACCAGCAACAGTTTATAAAT No data
Right 928476971 2:31637488-31637510 AAGTCAATTTATATGGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928476964 Original CRISPR ATTTATAAACTGTTGCTGGT GGG (reversed) Intergenic
No off target data available for this crispr