ID: 928477827

View in Genome Browser
Species Human (GRCh38)
Location 2:31649072-31649094
Sequence GAAACATGGTTGGGTTCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928477827_928477833 20 Left 928477827 2:31649072-31649094 CCTCTAGAACCCAACCATGTTTC No data
Right 928477833 2:31649115-31649137 ATCACATTTCTCATTTGGAGTGG No data
928477827_928477832 15 Left 928477827 2:31649072-31649094 CCTCTAGAACCCAACCATGTTTC No data
Right 928477832 2:31649110-31649132 AGCACATCACATTTCTCATTTGG No data
928477827_928477834 28 Left 928477827 2:31649072-31649094 CCTCTAGAACCCAACCATGTTTC No data
Right 928477834 2:31649123-31649145 TCTCATTTGGAGTGGATAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928477827 Original CRISPR GAAACATGGTTGGGTTCTAG AGG (reversed) Intergenic
No off target data available for this crispr