ID: 928477832

View in Genome Browser
Species Human (GRCh38)
Location 2:31649110-31649132
Sequence AGCACATCACATTTCTCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928477831_928477832 -9 Left 928477831 2:31649096-31649118 CCAATATGTTTTCTAGCACATCA No data
Right 928477832 2:31649110-31649132 AGCACATCACATTTCTCATTTGG No data
928477828_928477832 6 Left 928477828 2:31649081-31649103 CCCAACCATGTTTCTCCAATATG No data
Right 928477832 2:31649110-31649132 AGCACATCACATTTCTCATTTGG No data
928477829_928477832 5 Left 928477829 2:31649082-31649104 CCAACCATGTTTCTCCAATATGT No data
Right 928477832 2:31649110-31649132 AGCACATCACATTTCTCATTTGG No data
928477827_928477832 15 Left 928477827 2:31649072-31649094 CCTCTAGAACCCAACCATGTTTC No data
Right 928477832 2:31649110-31649132 AGCACATCACATTTCTCATTTGG No data
928477830_928477832 1 Left 928477830 2:31649086-31649108 CCATGTTTCTCCAATATGTTTTC No data
Right 928477832 2:31649110-31649132 AGCACATCACATTTCTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928477832 Original CRISPR AGCACATCACATTTCTCATT TGG Intergenic
No off target data available for this crispr