ID: 928477834

View in Genome Browser
Species Human (GRCh38)
Location 2:31649123-31649145
Sequence TCTCATTTGGAGTGGATAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928477830_928477834 14 Left 928477830 2:31649086-31649108 CCATGTTTCTCCAATATGTTTTC No data
Right 928477834 2:31649123-31649145 TCTCATTTGGAGTGGATAACTGG No data
928477829_928477834 18 Left 928477829 2:31649082-31649104 CCAACCATGTTTCTCCAATATGT No data
Right 928477834 2:31649123-31649145 TCTCATTTGGAGTGGATAACTGG No data
928477831_928477834 4 Left 928477831 2:31649096-31649118 CCAATATGTTTTCTAGCACATCA No data
Right 928477834 2:31649123-31649145 TCTCATTTGGAGTGGATAACTGG No data
928477827_928477834 28 Left 928477827 2:31649072-31649094 CCTCTAGAACCCAACCATGTTTC No data
Right 928477834 2:31649123-31649145 TCTCATTTGGAGTGGATAACTGG No data
928477828_928477834 19 Left 928477828 2:31649081-31649103 CCCAACCATGTTTCTCCAATATG No data
Right 928477834 2:31649123-31649145 TCTCATTTGGAGTGGATAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928477834 Original CRISPR TCTCATTTGGAGTGGATAAC TGG Intergenic
No off target data available for this crispr