ID: 928478396

View in Genome Browser
Species Human (GRCh38)
Location 2:31654957-31654979
Sequence CAGAACTTGGAGAAGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928478396_928478400 14 Left 928478396 2:31654957-31654979 CCTTTCTTCTTCTCCAAGTTCTG No data
Right 928478400 2:31654994-31655016 GCAGATATGAGTCAAATAGGAGG No data
928478396_928478402 16 Left 928478396 2:31654957-31654979 CCTTTCTTCTTCTCCAAGTTCTG No data
Right 928478402 2:31654996-31655018 AGATATGAGTCAAATAGGAGGGG No data
928478396_928478399 11 Left 928478396 2:31654957-31654979 CCTTTCTTCTTCTCCAAGTTCTG No data
Right 928478399 2:31654991-31655013 TAAGCAGATATGAGTCAAATAGG No data
928478396_928478401 15 Left 928478396 2:31654957-31654979 CCTTTCTTCTTCTCCAAGTTCTG No data
Right 928478401 2:31654995-31655017 CAGATATGAGTCAAATAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928478396 Original CRISPR CAGAACTTGGAGAAGAAGAA AGG (reversed) Intergenic
No off target data available for this crispr