ID: 928478400

View in Genome Browser
Species Human (GRCh38)
Location 2:31654994-31655016
Sequence GCAGATATGAGTCAAATAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928478397_928478400 1 Left 928478397 2:31654970-31654992 CCAAGTTCTGAACCAAATTGATA No data
Right 928478400 2:31654994-31655016 GCAGATATGAGTCAAATAGGAGG No data
928478396_928478400 14 Left 928478396 2:31654957-31654979 CCTTTCTTCTTCTCCAAGTTCTG No data
Right 928478400 2:31654994-31655016 GCAGATATGAGTCAAATAGGAGG No data
928478395_928478400 30 Left 928478395 2:31654941-31654963 CCAGGTACTAATTATACCTTTCT No data
Right 928478400 2:31654994-31655016 GCAGATATGAGTCAAATAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928478400 Original CRISPR GCAGATATGAGTCAAATAGG AGG Intergenic
No off target data available for this crispr