ID: 928478401

View in Genome Browser
Species Human (GRCh38)
Location 2:31654995-31655017
Sequence CAGATATGAGTCAAATAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928478398_928478401 -10 Left 928478398 2:31654982-31655004 CCAAATTGATAAGCAGATATGAG No data
Right 928478401 2:31654995-31655017 CAGATATGAGTCAAATAGGAGGG No data
928478396_928478401 15 Left 928478396 2:31654957-31654979 CCTTTCTTCTTCTCCAAGTTCTG No data
Right 928478401 2:31654995-31655017 CAGATATGAGTCAAATAGGAGGG No data
928478397_928478401 2 Left 928478397 2:31654970-31654992 CCAAGTTCTGAACCAAATTGATA No data
Right 928478401 2:31654995-31655017 CAGATATGAGTCAAATAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928478401 Original CRISPR CAGATATGAGTCAAATAGGA GGG Intergenic
No off target data available for this crispr