ID: 928478402

View in Genome Browser
Species Human (GRCh38)
Location 2:31654996-31655018
Sequence AGATATGAGTCAAATAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928478398_928478402 -9 Left 928478398 2:31654982-31655004 CCAAATTGATAAGCAGATATGAG No data
Right 928478402 2:31654996-31655018 AGATATGAGTCAAATAGGAGGGG No data
928478396_928478402 16 Left 928478396 2:31654957-31654979 CCTTTCTTCTTCTCCAAGTTCTG No data
Right 928478402 2:31654996-31655018 AGATATGAGTCAAATAGGAGGGG No data
928478397_928478402 3 Left 928478397 2:31654970-31654992 CCAAGTTCTGAACCAAATTGATA No data
Right 928478402 2:31654996-31655018 AGATATGAGTCAAATAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928478402 Original CRISPR AGATATGAGTCAAATAGGAG GGG Intergenic
No off target data available for this crispr