ID: 928479371

View in Genome Browser
Species Human (GRCh38)
Location 2:31666507-31666529
Sequence ATCAAAGGACATAAGCTATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928479367_928479371 -5 Left 928479367 2:31666489-31666511 CCATTAGTCAGGCGGAACATCAA No data
Right 928479371 2:31666507-31666529 ATCAAAGGACATAAGCTATGGGG No data
928479364_928479371 15 Left 928479364 2:31666469-31666491 CCTGAAGGAGAATGGACAGGCCA No data
Right 928479371 2:31666507-31666529 ATCAAAGGACATAAGCTATGGGG No data
928479361_928479371 25 Left 928479361 2:31666459-31666481 CCTTATGTGTCCTGAAGGAGAAT No data
Right 928479371 2:31666507-31666529 ATCAAAGGACATAAGCTATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928479371 Original CRISPR ATCAAAGGACATAAGCTATG GGG Intergenic
No off target data available for this crispr