ID: 928481891

View in Genome Browser
Species Human (GRCh38)
Location 2:31691887-31691909
Sequence GTATAAGGATTAGGGGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928481885_928481891 0 Left 928481885 2:31691864-31691886 CCTCAGGTAATTGAGTCAGCAAG No data
Right 928481891 2:31691887-31691909 GTATAAGGATTAGGGGCCACTGG No data
928481882_928481891 25 Left 928481882 2:31691839-31691861 CCTAGGACTGTGAACTATTTAGT No data
Right 928481891 2:31691887-31691909 GTATAAGGATTAGGGGCCACTGG No data
928481884_928481891 1 Left 928481884 2:31691863-31691885 CCCTCAGGTAATTGAGTCAGCAA No data
Right 928481891 2:31691887-31691909 GTATAAGGATTAGGGGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928481891 Original CRISPR GTATAAGGATTAGGGGCCAC TGG Intergenic
No off target data available for this crispr