ID: 928483942

View in Genome Browser
Species Human (GRCh38)
Location 2:31710934-31710956
Sequence GGCCAGTGATGGGGGTCGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928483942_928483953 15 Left 928483942 2:31710934-31710956 CCACACGACCCCCATCACTGGCC No data
Right 928483953 2:31710972-31710994 AGAATCTGTGTGCTTGGGGGAGG No data
928483942_928483954 16 Left 928483942 2:31710934-31710956 CCACACGACCCCCATCACTGGCC No data
Right 928483954 2:31710973-31710995 GAATCTGTGTGCTTGGGGGAGGG No data
928483942_928483952 12 Left 928483942 2:31710934-31710956 CCACACGACCCCCATCACTGGCC No data
Right 928483952 2:31710969-31710991 GAGAGAATCTGTGTGCTTGGGGG No data
928483942_928483949 9 Left 928483942 2:31710934-31710956 CCACACGACCCCCATCACTGGCC No data
Right 928483949 2:31710966-31710988 AGAGAGAGAATCTGTGTGCTTGG No data
928483942_928483950 10 Left 928483942 2:31710934-31710956 CCACACGACCCCCATCACTGGCC No data
Right 928483950 2:31710967-31710989 GAGAGAGAATCTGTGTGCTTGGG No data
928483942_928483951 11 Left 928483942 2:31710934-31710956 CCACACGACCCCCATCACTGGCC No data
Right 928483951 2:31710968-31710990 AGAGAGAATCTGTGTGCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928483942 Original CRISPR GGCCAGTGATGGGGGTCGTG TGG (reversed) Intergenic