ID: 928483947

View in Genome Browser
Species Human (GRCh38)
Location 2:31710945-31710967
Sequence CTGTGCCATGTGGCCAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928483947_928483953 4 Left 928483947 2:31710945-31710967 CCATCACTGGCCACATGGCACAG No data
Right 928483953 2:31710972-31710994 AGAATCTGTGTGCTTGGGGGAGG No data
928483947_928483952 1 Left 928483947 2:31710945-31710967 CCATCACTGGCCACATGGCACAG No data
Right 928483952 2:31710969-31710991 GAGAGAATCTGTGTGCTTGGGGG No data
928483947_928483955 23 Left 928483947 2:31710945-31710967 CCATCACTGGCCACATGGCACAG No data
Right 928483955 2:31710991-31711013 GAGGGAGAGCAAAGTGATTGTGG No data
928483947_928483954 5 Left 928483947 2:31710945-31710967 CCATCACTGGCCACATGGCACAG No data
Right 928483954 2:31710973-31710995 GAATCTGTGTGCTTGGGGGAGGG No data
928483947_928483951 0 Left 928483947 2:31710945-31710967 CCATCACTGGCCACATGGCACAG No data
Right 928483951 2:31710968-31710990 AGAGAGAATCTGTGTGCTTGGGG No data
928483947_928483956 24 Left 928483947 2:31710945-31710967 CCATCACTGGCCACATGGCACAG No data
Right 928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG No data
928483947_928483950 -1 Left 928483947 2:31710945-31710967 CCATCACTGGCCACATGGCACAG No data
Right 928483950 2:31710967-31710989 GAGAGAGAATCTGTGTGCTTGGG No data
928483947_928483949 -2 Left 928483947 2:31710945-31710967 CCATCACTGGCCACATGGCACAG No data
Right 928483949 2:31710966-31710988 AGAGAGAGAATCTGTGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928483947 Original CRISPR CTGTGCCATGTGGCCAGTGA TGG (reversed) Intergenic