ID: 928483948

View in Genome Browser
Species Human (GRCh38)
Location 2:31710955-31710977
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928483948_928483953 -6 Left 928483948 2:31710955-31710977 CCACATGGCACAGAGAGAGAATC No data
Right 928483953 2:31710972-31710994 AGAATCTGTGTGCTTGGGGGAGG No data
928483948_928483954 -5 Left 928483948 2:31710955-31710977 CCACATGGCACAGAGAGAGAATC No data
Right 928483954 2:31710973-31710995 GAATCTGTGTGCTTGGGGGAGGG No data
928483948_928483955 13 Left 928483948 2:31710955-31710977 CCACATGGCACAGAGAGAGAATC No data
Right 928483955 2:31710991-31711013 GAGGGAGAGCAAAGTGATTGTGG No data
928483948_928483951 -10 Left 928483948 2:31710955-31710977 CCACATGGCACAGAGAGAGAATC No data
Right 928483951 2:31710968-31710990 AGAGAGAATCTGTGTGCTTGGGG No data
928483948_928483952 -9 Left 928483948 2:31710955-31710977 CCACATGGCACAGAGAGAGAATC No data
Right 928483952 2:31710969-31710991 GAGAGAATCTGTGTGCTTGGGGG No data
928483948_928483956 14 Left 928483948 2:31710955-31710977 CCACATGGCACAGAGAGAGAATC No data
Right 928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG No data
928483948_928483957 26 Left 928483948 2:31710955-31710977 CCACATGGCACAGAGAGAGAATC No data
Right 928483957 2:31711004-31711026 GTGATTGTGGGACTTTGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928483948 Original CRISPR GATTCTCTCTCTGTGCCATG TGG (reversed) Intergenic