ID: 928483949

View in Genome Browser
Species Human (GRCh38)
Location 2:31710966-31710988
Sequence AGAGAGAGAATCTGTGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928483940_928483949 15 Left 928483940 2:31710928-31710950 CCTACACCACACGACCCCCATCA No data
Right 928483949 2:31710966-31710988 AGAGAGAGAATCTGTGTGCTTGG No data
928483945_928483949 0 Left 928483945 2:31710943-31710965 CCCCATCACTGGCCACATGGCAC No data
Right 928483949 2:31710966-31710988 AGAGAGAGAATCTGTGTGCTTGG No data
928483944_928483949 1 Left 928483944 2:31710942-31710964 CCCCCATCACTGGCCACATGGCA No data
Right 928483949 2:31710966-31710988 AGAGAGAGAATCTGTGTGCTTGG No data
928483947_928483949 -2 Left 928483947 2:31710945-31710967 CCATCACTGGCCACATGGCACAG No data
Right 928483949 2:31710966-31710988 AGAGAGAGAATCTGTGTGCTTGG No data
928483946_928483949 -1 Left 928483946 2:31710944-31710966 CCCATCACTGGCCACATGGCACA No data
Right 928483949 2:31710966-31710988 AGAGAGAGAATCTGTGTGCTTGG No data
928483942_928483949 9 Left 928483942 2:31710934-31710956 CCACACGACCCCCATCACTGGCC No data
Right 928483949 2:31710966-31710988 AGAGAGAGAATCTGTGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928483949 Original CRISPR AGAGAGAGAATCTGTGTGCT TGG Intergenic