ID: 928483951

View in Genome Browser
Species Human (GRCh38)
Location 2:31710968-31710990
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928483942_928483951 11 Left 928483942 2:31710934-31710956 CCACACGACCCCCATCACTGGCC No data
Right 928483951 2:31710968-31710990 AGAGAGAATCTGTGTGCTTGGGG No data
928483947_928483951 0 Left 928483947 2:31710945-31710967 CCATCACTGGCCACATGGCACAG No data
Right 928483951 2:31710968-31710990 AGAGAGAATCTGTGTGCTTGGGG No data
928483946_928483951 1 Left 928483946 2:31710944-31710966 CCCATCACTGGCCACATGGCACA No data
Right 928483951 2:31710968-31710990 AGAGAGAATCTGTGTGCTTGGGG No data
928483940_928483951 17 Left 928483940 2:31710928-31710950 CCTACACCACACGACCCCCATCA No data
Right 928483951 2:31710968-31710990 AGAGAGAATCTGTGTGCTTGGGG No data
928483948_928483951 -10 Left 928483948 2:31710955-31710977 CCACATGGCACAGAGAGAGAATC No data
Right 928483951 2:31710968-31710990 AGAGAGAATCTGTGTGCTTGGGG No data
928483944_928483951 3 Left 928483944 2:31710942-31710964 CCCCCATCACTGGCCACATGGCA No data
Right 928483951 2:31710968-31710990 AGAGAGAATCTGTGTGCTTGGGG No data
928483945_928483951 2 Left 928483945 2:31710943-31710965 CCCCATCACTGGCCACATGGCAC No data
Right 928483951 2:31710968-31710990 AGAGAGAATCTGTGTGCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type