ID: 928483955

View in Genome Browser
Species Human (GRCh38)
Location 2:31710991-31711013
Sequence GAGGGAGAGCAAAGTGATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928483946_928483955 24 Left 928483946 2:31710944-31710966 CCCATCACTGGCCACATGGCACA No data
Right 928483955 2:31710991-31711013 GAGGGAGAGCAAAGTGATTGTGG No data
928483948_928483955 13 Left 928483948 2:31710955-31710977 CCACATGGCACAGAGAGAGAATC No data
Right 928483955 2:31710991-31711013 GAGGGAGAGCAAAGTGATTGTGG No data
928483947_928483955 23 Left 928483947 2:31710945-31710967 CCATCACTGGCCACATGGCACAG No data
Right 928483955 2:31710991-31711013 GAGGGAGAGCAAAGTGATTGTGG No data
928483945_928483955 25 Left 928483945 2:31710943-31710965 CCCCATCACTGGCCACATGGCAC No data
Right 928483955 2:31710991-31711013 GAGGGAGAGCAAAGTGATTGTGG No data
928483944_928483955 26 Left 928483944 2:31710942-31710964 CCCCCATCACTGGCCACATGGCA No data
Right 928483955 2:31710991-31711013 GAGGGAGAGCAAAGTGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928483955 Original CRISPR GAGGGAGAGCAAAGTGATTG TGG Intergenic