ID: 928483956

View in Genome Browser
Species Human (GRCh38)
Location 2:31710992-31711014
Sequence AGGGAGAGCAAAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928483946_928483956 25 Left 928483946 2:31710944-31710966 CCCATCACTGGCCACATGGCACA No data
Right 928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG No data
928483944_928483956 27 Left 928483944 2:31710942-31710964 CCCCCATCACTGGCCACATGGCA No data
Right 928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG No data
928483945_928483956 26 Left 928483945 2:31710943-31710965 CCCCATCACTGGCCACATGGCAC No data
Right 928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG No data
928483948_928483956 14 Left 928483948 2:31710955-31710977 CCACATGGCACAGAGAGAGAATC No data
Right 928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG No data
928483947_928483956 24 Left 928483947 2:31710945-31710967 CCATCACTGGCCACATGGCACAG No data
Right 928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928483956 Original CRISPR AGGGAGAGCAAAGTGATTGT GGG Intergenic
No off target data available for this crispr