ID: 928484200

View in Genome Browser
Species Human (GRCh38)
Location 2:31712581-31712603
Sequence TTTTGGGCCTTGAGTGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928484197_928484200 -6 Left 928484197 2:31712564-31712586 CCTGATGCTTGCAGAGCTTTTGG No data
Right 928484200 2:31712581-31712603 TTTTGGGCCTTGAGTGAACCAGG No data
928484195_928484200 11 Left 928484195 2:31712547-31712569 CCTGGCAGTATTTACCACCTGAT No data
Right 928484200 2:31712581-31712603 TTTTGGGCCTTGAGTGAACCAGG No data
928484196_928484200 -3 Left 928484196 2:31712561-31712583 CCACCTGATGCTTGCAGAGCTTT No data
Right 928484200 2:31712581-31712603 TTTTGGGCCTTGAGTGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928484200 Original CRISPR TTTTGGGCCTTGAGTGAACC AGG Intergenic
No off target data available for this crispr