ID: 928487150

View in Genome Browser
Species Human (GRCh38)
Location 2:31744305-31744327
Sequence AATTCCTAGAAACTTCACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928487147_928487150 -10 Left 928487147 2:31744292-31744314 CCCCAGACTACACAATTCCTAGA No data
Right 928487150 2:31744305-31744327 AATTCCTAGAAACTTCACTAAGG No data
928487146_928487150 -3 Left 928487146 2:31744285-31744307 CCATATGCCCCAGACTACACAAT No data
Right 928487150 2:31744305-31744327 AATTCCTAGAAACTTCACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928487150 Original CRISPR AATTCCTAGAAACTTCACTA AGG Intergenic
No off target data available for this crispr