ID: 928488811

View in Genome Browser
Species Human (GRCh38)
Location 2:31759659-31759681
Sequence GCAGATTCTGGGCAGCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928488811_928488819 15 Left 928488811 2:31759659-31759681 CCTCTGTGCTGCCCAGAATCTGC No data
Right 928488819 2:31759697-31759719 ATCTCCCCTCTGAATCCTGAGGG No data
928488811_928488818 14 Left 928488811 2:31759659-31759681 CCTCTGTGCTGCCCAGAATCTGC No data
Right 928488818 2:31759696-31759718 CATCTCCCCTCTGAATCCTGAGG No data
928488811_928488815 -10 Left 928488811 2:31759659-31759681 CCTCTGTGCTGCCCAGAATCTGC No data
Right 928488815 2:31759672-31759694 CAGAATCTGCCCTAAGCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928488811 Original CRISPR GCAGATTCTGGGCAGCACAG AGG (reversed) Intergenic