ID: 928494932

View in Genome Browser
Species Human (GRCh38)
Location 2:31821936-31821958
Sequence TGTTATTTGCAGAACATGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928494932_928494935 16 Left 928494932 2:31821936-31821958 CCATACATGTTCTGCAAATAACA No data
Right 928494935 2:31821975-31821997 TATGGCTGCATAGTATTGCCTGG No data
928494932_928494933 -2 Left 928494932 2:31821936-31821958 CCATACATGTTCTGCAAATAACA No data
Right 928494933 2:31821957-31821979 CATAATCTTATTCCTTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928494932 Original CRISPR TGTTATTTGCAGAACATGTA TGG (reversed) Intergenic
No off target data available for this crispr