ID: 928495586

View in Genome Browser
Species Human (GRCh38)
Location 2:31828657-31828679
Sequence CTGTGGACACACCTGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928495586_928495590 2 Left 928495586 2:31828657-31828679 CCAGGCTCCAGGTGTGTCCACAG No data
Right 928495590 2:31828682-31828704 GCTGTTTGTGAGCCAAGGACTGG No data
928495586_928495589 -3 Left 928495586 2:31828657-31828679 CCAGGCTCCAGGTGTGTCCACAG No data
Right 928495589 2:31828677-31828699 CAGATGCTGTTTGTGAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928495586 Original CRISPR CTGTGGACACACCTGGAGCC TGG (reversed) Intergenic
No off target data available for this crispr