ID: 928496965

View in Genome Browser
Species Human (GRCh38)
Location 2:31842834-31842856
Sequence TTATAGACAAAGGTTGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928496957_928496965 -4 Left 928496957 2:31842815-31842837 CCCACAGGGCAGCCATATATTAT No data
Right 928496965 2:31842834-31842856 TTATAGACAAAGGTTGAGGGGGG No data
928496958_928496965 -5 Left 928496958 2:31842816-31842838 CCACAGGGCAGCCATATATTATA No data
Right 928496965 2:31842834-31842856 TTATAGACAAAGGTTGAGGGGGG No data
928496956_928496965 -3 Left 928496956 2:31842814-31842836 CCCCACAGGGCAGCCATATATTA No data
Right 928496965 2:31842834-31842856 TTATAGACAAAGGTTGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928496965 Original CRISPR TTATAGACAAAGGTTGAGGG GGG Intergenic
No off target data available for this crispr