ID: 928499646

View in Genome Browser
Species Human (GRCh38)
Location 2:31876891-31876913
Sequence TGGTAATTTAGACAGTGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928499646_928499649 -8 Left 928499646 2:31876891-31876913 CCTACCCACTGTCTAAATTACCA 0: 1
1: 0
2: 0
3: 8
4: 142
Right 928499649 2:31876906-31876928 AATTACCATAGTTTCTCATCTGG 0: 1
1: 0
2: 1
3: 11
4: 168
928499646_928499651 5 Left 928499646 2:31876891-31876913 CCTACCCACTGTCTAAATTACCA 0: 1
1: 0
2: 0
3: 8
4: 142
Right 928499651 2:31876919-31876941 TCTCATCTGGACTACCTAACTGG 0: 1
1: 0
2: 0
3: 7
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928499646 Original CRISPR TGGTAATTTAGACAGTGGGT AGG (reversed) Intronic
901144190 1:7054079-7054101 TGGTAATTAAGTCAGAGGCTGGG - Intronic
903192491 1:21664476-21664498 TGGCAATGTGGACACTGGGTTGG - Intronic
904511364 1:31011657-31011679 TGGTATTTATGCCAGTGGGTTGG - Intronic
905022131 1:34825367-34825389 TGGAAAACAAGACAGTGGGTGGG + Intronic
906559067 1:46741248-46741270 TGGTAATTAAGACAGTGTGGCGG - Intergenic
907246482 1:53112506-53112528 AGTTTCTTTAGACAGTGGGTGGG + Intronic
909107379 1:71429654-71429676 TGGCAATTAAAACATTGGGTAGG + Intronic
911100087 1:94088627-94088649 TGGAGATTTAGACAATGGGATGG - Intronic
914412063 1:147438865-147438887 TGCTAATCTAGTCAGGGGGTGGG - Intergenic
915100398 1:153495140-153495162 TCTTAATTTAGAAAGTGGGTGGG - Intergenic
918555900 1:185799354-185799376 TGGTACCTTAGGCAGTGGGCTGG + Intronic
918777197 1:188648874-188648896 AGATAACTTAGACTGTGGGTTGG - Intergenic
921349988 1:214225142-214225164 GGGTAATTCAGACGGTGAGTAGG + Intergenic
923055309 1:230422392-230422414 TGGTTATTTGCACAGTGGGCAGG + Intronic
924008198 1:239635536-239635558 TGGTTATTTAGAGAGCGGTTAGG - Intronic
924767657 1:247048570-247048592 TGGTACTGTAGAGAGTGGGGTGG - Intronic
924815375 1:247437064-247437086 TGGGAATTAAGGCAGTGGCTTGG - Intronic
1065986363 10:30957002-30957024 TGTTAATTTACACTGTTGGTGGG - Intronic
1069039373 10:63678978-63679000 TGGTAGTTTAGAAGGTGGGAAGG + Intergenic
1073731812 10:106296977-106296999 TAGTAATTTAGACAAAGTGTTGG + Intergenic
1078140041 11:8685580-8685602 TAGGGATTTAGAAAGTGGGTTGG + Intronic
1085915980 11:80888364-80888386 TAGTAATTTAGAAAGAGAGTGGG + Intergenic
1090522126 11:127490496-127490518 TGGTAATGTAGACAGCTGCTAGG - Intergenic
1093670954 12:21875389-21875411 GGGCAATTTAAACAGTGGGGTGG - Intronic
1093773495 12:23045232-23045254 TGGTGCTTTAGACAGTTGGTGGG - Intergenic
1097168521 12:57098985-57099007 TGGTGGTATGGACAGTGGGTAGG - Intronic
1097764787 12:63513315-63513337 TGGCAATTTGGAAAGTGGATAGG - Intergenic
1101505480 12:105342293-105342315 TGGTTATTGAGAGAGTGGGCTGG + Intronic
1102377687 12:112436464-112436486 TGGGATTTGAGACAGTGGTTTGG + Intronic
1103859489 12:124000865-124000887 TGGTAACTTAAACAGGGGGAGGG - Intronic
1108478270 13:50842815-50842837 TATTAATTTGGAAAGTGGGTGGG + Intronic
1110787012 13:79540433-79540455 TAGTAATTTAAACAGTTGATTGG - Intronic
1111742293 13:92219184-92219206 TAGTAAGTGACACAGTGGGTAGG - Intronic
1112019947 13:95362896-95362918 TGATAATTTGGACAGGGAGTGGG - Intergenic
1112020501 13:95367147-95367169 TGGTAACATAGGCAGTGGGCAGG - Intergenic
1114533247 14:23408314-23408336 TCCAAATTTAGACAGAGGGTGGG - Intergenic
1117580252 14:57144486-57144508 TGGGAAGGGAGACAGTGGGTGGG - Intergenic
1117952789 14:61099629-61099651 GGGTAATTCTGAAAGTGGGTGGG - Intergenic
1118409296 14:65460949-65460971 TGCTAATTAAGACAGTGGACTGG + Intronic
1120338717 14:83191397-83191419 TGATGATTAAGACAGTGGGGAGG - Intergenic
1121814181 14:96916394-96916416 TGTGAATTTGGACAGCGGGTTGG - Intronic
1123981404 15:25607974-25607996 TGGTAAATTATACAGTGTGTTGG - Intergenic
1124478965 15:30061162-30061184 TTGTAATTTATTCAGTAGGTAGG + Intergenic
1126887528 15:53166666-53166688 TGGTAATTTAGCCAGTGTAAAGG + Intergenic
1129101198 15:73265727-73265749 TGGCAATCTAGGGAGTGGGTGGG + Intronic
1131033310 15:89204558-89204580 TGTTACTTTGGACAGTGGTTTGG + Intergenic
1133498976 16:6347248-6347270 TGGTAATGTAGACAGTGAACGGG + Intronic
1133594273 16:7275595-7275617 TGCTAATTTAGATGGTAGGTTGG + Intronic
1138258156 16:55588319-55588341 TTGAGATTTAGACTGTGGGTAGG - Intergenic
1138743006 16:59332356-59332378 TGGGAATTTAGGTAGTGGGGTGG + Intergenic
1139048091 16:63087804-63087826 TGGTAATTTAGAAAATCAGTGGG + Intergenic
1139556606 16:67715451-67715473 TTATAAATTAGACATTGGGTTGG - Intronic
1141808048 16:86354962-86354984 TGATCACTTGGACAGTGGGTAGG - Intergenic
1143201686 17:5117639-5117661 TGGAAATTTAGAGAGGGGGATGG + Intronic
1145961408 17:28888422-28888444 TGGTAAGTTAGACAGGGAGGGGG - Intronic
1146932842 17:36790365-36790387 TGGTGGTGTAGACAGTGGATGGG + Intergenic
1153986627 18:10356779-10356801 GGTTACTATAGACAGTGGGTTGG - Intergenic
1153986641 18:10356880-10356902 GGTTACTGTAGACAGTGGGTTGG - Intergenic
1154106584 18:11528662-11528684 TGTTTATCTAGACAGTGGGCTGG - Intergenic
1155050820 18:22146381-22146403 TGGGATTTGAGACAGAGGGTGGG + Intergenic
1159456386 18:68664377-68664399 TTTGAATTTACACAGTGGGTGGG - Intergenic
1160539209 18:79611296-79611318 TGCTAATTAGCACAGTGGGTTGG + Intergenic
1162399548 19:10436584-10436606 TGTTAACTTATAGAGTGGGTTGG + Intronic
1168654437 19:58117434-58117456 TGGGAATGTTCACAGTGGGTAGG + Intronic
928499646 2:31876891-31876913 TGGTAATTTAGACAGTGGGTAGG - Intronic
929740403 2:44593618-44593640 TGGTATTCAAGACAGTGGGCAGG - Intronic
930354450 2:50300066-50300088 TGTTAATTTAGAAAGGAGGTGGG + Intronic
931520087 2:63086951-63086973 TGGGAATTTAGGCATGGGGTTGG + Intergenic
931932560 2:67156270-67156292 TGGGAGTTAAGACAGTGGTTTGG + Intergenic
934774910 2:96931122-96931144 TGTTAAATTTGACAATGGGTGGG + Intronic
935689627 2:105719187-105719209 TTCTAATTTAGGCAGTGGGAGGG - Intergenic
939530983 2:143361604-143361626 TTTTAATTAAGACAGAGGGTAGG - Intronic
941422186 2:165296178-165296200 TGATACTTTAGACAGAGGGAAGG - Intronic
941636257 2:167937827-167937849 TGGTAATTGAGATTGTGGATAGG + Intergenic
944909640 2:204297324-204297346 TTTTAAGTTAAACAGTGGGTAGG - Intergenic
1171445423 20:25199357-25199379 TTGTATTTGACACAGTGGGTGGG + Intronic
1173647465 20:44642412-44642434 GGGCAATTTAGAAAGTGTGTTGG + Intronic
1174913407 20:54630995-54631017 TGGTAAATTAAACAGTGGTTAGG + Intronic
1179602468 21:42489310-42489332 TGGTTGGTTAGACAGTTGGTTGG + Intronic
1181590789 22:23883776-23883798 TGGTAATCGAGAGGGTGGGTCGG + Exonic
1181639772 22:24190393-24190415 TGGGGATTCAGACAGTGGGAGGG - Intergenic
1183842384 22:40510167-40510189 TTGTAAATTATACAGTGGCTGGG - Intronic
953510621 3:43534663-43534685 TGGACATTGGGACAGTGGGTCGG - Intronic
955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG + Intronic
960527511 3:118726569-118726591 GGGTAAATTAAACAGTGGATTGG + Intergenic
961334041 3:126159568-126159590 TGGTAGTTTTGAGAGAGGGTGGG + Intronic
963103258 3:141624874-141624896 TGGTGATCTGGACTGTGGGTGGG - Intergenic
965941312 3:174185294-174185316 TGCTGATTTAGACAATGTGTGGG - Intronic
966505531 3:180697081-180697103 GGGTCTTTTAGACAGTGGGGTGG + Intronic
966548108 3:181173806-181173828 TGGTAATTTCTACAGTGATTTGG + Intergenic
966690192 3:182733532-182733554 TTGTAATTTAGCCATAGGGTTGG - Intergenic
967714725 3:192749376-192749398 CAGCATTTTAGACAGTGGGTGGG - Intronic
969099790 4:4760259-4760281 TGGTCATTTACAAAGTGCGTTGG + Intergenic
970093773 4:12438914-12438936 TGGTAAAAAAGACAGTGGGAGGG + Intergenic
972301051 4:37786044-37786066 TGGAAATATAGACAGTGTCTGGG + Intergenic
974490395 4:62557263-62557285 TGGTTCCTTAGACAATGGGTGGG + Intergenic
974584250 4:63851250-63851272 AGGTAAATTAGACAGTAAGTTGG + Intergenic
977114072 4:92999177-92999199 TGCAAATTTTGACAGTGGCTAGG - Intronic
977409878 4:96649393-96649415 TGGTATTTGAGACAGTGTGAAGG - Intergenic
978398778 4:108310036-108310058 TGGTGATATGGACAGGGGGTAGG + Intergenic
981930203 4:150181337-150181359 TGGGAATTAAGACTGGGGGTAGG + Intronic
984482105 4:180318690-180318712 GGGTAGTGTAGACAGTGGCTTGG + Intergenic
991434506 5:66583561-66583583 TAGAAATTTGGACAGTGGGTGGG + Intergenic
993313098 5:86362287-86362309 TGGTAAATAAGACAGTGAGAGGG + Intergenic
993638668 5:90376096-90376118 TGATAATTTAGAAAGAGGTTTGG - Intergenic
996328984 5:122309568-122309590 TGGTAAATGAGCCAGTGGCTGGG + Intergenic
997497550 5:134342902-134342924 TAGTCATTAAGACAGTGTGTCGG + Intronic
998485146 5:142495461-142495483 TTGTAATATAGACAGATGGTAGG - Intergenic
1001764598 5:174235444-174235466 TGGTAATGAAGCCAGGGGGTGGG + Intronic
1002834522 6:854841-854863 TTTTTATTTGGACAGTGGGTGGG - Intergenic
1004967310 6:20868371-20868393 TTGTAATTTACACACTAGGTTGG + Intronic
1007746873 6:44048421-44048443 TGGTGATTTGGGCAGGGGGTTGG - Intergenic
1008868579 6:56245766-56245788 GGGAAATTTAGATAGTGGTTAGG - Intronic
1009499041 6:64388208-64388230 TGGAAATTTAAAGAGTGGGCTGG + Intronic
1009928924 6:70153157-70153179 CAGGAATTTAGACTGTGGGTTGG + Intronic
1010627162 6:78152648-78152670 TGGTCATTTATATAGTGTGTGGG - Intergenic
1011057924 6:83226128-83226150 TGAAAATTTAGACACTGGTTTGG - Intronic
1018881970 6:167893006-167893028 AGGTAATTCACACAGTGGGAGGG + Intronic
1019398051 7:834083-834105 TGGGAATTTAGACTCTTGGTGGG + Intronic
1019398065 7:834136-834158 TGGGAATTTAGACTCTTGGTGGG + Intronic
1019398080 7:834189-834211 TGGGAATTTAGACTCTTGGTGGG + Intronic
1021344346 7:19506607-19506629 TGGGAATTTAAAAAGTTGGTAGG + Intergenic
1026555601 7:71406065-71406087 TGGTAATTTAACCAGTGAATGGG - Intronic
1027990745 7:85357792-85357814 TGGTAATTTAAACTGTGTGATGG - Intergenic
1028018540 7:85743673-85743695 GGGTAATCTAGACAGTCGCTTGG + Intergenic
1028420671 7:90629265-90629287 TGCTAATTTAGATGGTGGGGTGG - Intronic
1030122420 7:106123038-106123060 AGGTACTTTACACAGTAGGTGGG + Intergenic
1030233555 7:107233951-107233973 TTTTAATTTAAAAAGTGGGTGGG + Intronic
1033705089 7:143878888-143878910 TGGTAACTTAGAAATTGGGTCGG - Intronic
1039191551 8:34981905-34981927 TGGTAATTTAAAAAATGTGTAGG - Intergenic
1039719422 8:40146553-40146575 TGGTGATTTGGATAGAGGGTAGG - Intergenic
1042106640 8:65334421-65334443 TGGTAATGTAGAGTGTGGGATGG - Intergenic
1042166536 8:65951098-65951120 TGGTGACCTAGAGAGTGGGTGGG - Intergenic
1043311278 8:78863168-78863190 AGGTTATTTAGAAAGTGAGTTGG + Intergenic
1044572101 8:93731671-93731693 TGGTAATTTAGACATTTAATAGG - Exonic
1045124088 8:99070641-99070663 AGGTAATGTAGACAGTGGAGAGG - Intronic
1045748691 8:105455879-105455901 TGGTAATATAGCCAGGGGCTTGG + Intronic
1046254580 8:111679720-111679742 TGGTAACTTCGACAGCGGTTAGG + Intergenic
1047086472 8:121522285-121522307 TGGTAATGTGCACAGTGGTTAGG + Intergenic
1047839745 8:128738356-128738378 TGGAACTTGAGAAAGTGGGTGGG + Intergenic
1048419099 8:134259484-134259506 TGGACATTCAGACAGTGAGTAGG - Intergenic
1051097409 9:13482432-13482454 TGGTGACTTAGACACTGAGTGGG + Intergenic
1052679552 9:31671668-31671690 TGGCAATGTTCACAGTGGGTGGG + Intergenic
1054843368 9:69766877-69766899 TGGAAATTTAGAAAGGGAGTAGG + Intergenic
1187253049 X:17616291-17616313 TGTTATTTTATACATTGGGTGGG + Intronic
1187997513 X:24944388-24944410 TGCTAAGTTAGACAGGGGGTGGG - Intronic
1190955638 X:55190112-55190134 AGGTCATTTAGACAGTGTATGGG + Intronic
1194053385 X:89100646-89100668 TGGTTACTTAGGCAATGGGTAGG + Intergenic
1194510142 X:94783576-94783598 TGGTTTCTTAGGCAGTGGGTGGG - Intergenic
1194619649 X:96154417-96154439 TGGGAATTTAAAAAGTGTGTAGG - Intergenic
1196647504 X:118133634-118133656 TGGTAATTTGGACATGGGGCAGG - Intergenic