ID: 928499841

View in Genome Browser
Species Human (GRCh38)
Location 2:31879198-31879220
Sequence CCACTGAAACTGCTCTTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 1, 2: 6, 3: 43, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928499838_928499841 10 Left 928499838 2:31879165-31879187 CCTCTTCATTCCAATTTAGATTC 0: 1
1: 0
2: 1
3: 15
4: 219
Right 928499841 2:31879198-31879220 CCACTGAAACTGCTCTTGCAAGG 0: 1
1: 1
2: 6
3: 43
4: 177
928499839_928499841 0 Left 928499839 2:31879175-31879197 CCAATTTAGATTCTAAGCTGATT 0: 1
1: 0
2: 0
3: 18
4: 201
Right 928499841 2:31879198-31879220 CCACTGAAACTGCTCTTGCAAGG 0: 1
1: 1
2: 6
3: 43
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928499841 Original CRISPR CCACTGAAACTGCTCTTGCA AGG Intronic
900463567 1:2812948-2812970 CCACGGAAAATGCACTTGCAGGG - Intergenic
905097760 1:35488842-35488864 CCACTGAAGCTACTCTTGCCAGG - Intronic
906301909 1:44688792-44688814 CCACTGAAAATACTCTCCCAAGG + Intronic
909247421 1:73303989-73304011 CCACTGACCCTGCATTTGCAAGG + Intergenic
911189428 1:94933042-94933064 TCCCTGAAATTGCTCTTGTAAGG + Intergenic
915072848 1:153286441-153286463 CCACTGAAATTGCTCTTACTTGG - Intergenic
916630962 1:166611806-166611828 ACACTGAAACTTCTCTAGCAAGG + Intergenic
917008125 1:170438263-170438285 TCACTGAAACTTCTCCTGTAAGG + Intergenic
919511608 1:198472355-198472377 CCACTGAAACTGCACTGGGCAGG - Intergenic
920203140 1:204273009-204273031 CCACTCAAACTGCCCTTGTCAGG + Intronic
921456584 1:215379465-215379487 CCACTGAATGTCCCCTTGCAAGG + Intergenic
924457762 1:244231764-244231786 CCACTGAAAGTTCTCTCCCATGG - Intergenic
924606258 1:245538175-245538197 CATCTGAAACTGCTCTTGTCTGG - Intronic
1063090984 10:2866169-2866191 CCACTGAAGCTCATCCTGCAGGG + Intergenic
1066312237 10:34208657-34208679 CCCCTAGAACTGCTCATGCAGGG + Intronic
1071009824 10:80924917-80924939 CCACTGAAACTGCTCCTGCAAGG - Intergenic
1072166038 10:92813969-92813991 CCACTGAAATTACTCTTAAAAGG + Intergenic
1074145254 10:110711420-110711442 CCACTGCAATAGCTCTTGCCTGG + Intronic
1074368794 10:112882089-112882111 CTACTGAAACTTATCTTGCCCGG - Intergenic
1075172796 10:120131486-120131508 CATCTGAAACAGCTCTTTCAGGG + Intergenic
1075880751 10:125848695-125848717 CCATTAAAACTGCTCTTTCTAGG + Intronic
1075902236 10:126052200-126052222 CCACTGAACCTGTTGTTGCTTGG - Intronic
1076502983 10:130951511-130951533 CCAGTTCAACTGTTCTTGCAAGG + Intergenic
1077093215 11:788791-788813 CCTCTGACACTTCTCTTTCACGG + Intronic
1079781903 11:24617955-24617977 CCTCTGATACTACTCTGGCAGGG + Intronic
1080741641 11:35069740-35069762 CCTCTGACATTGCTCTGGCAAGG - Intergenic
1080763132 11:35271890-35271912 GTATTGAAACTGCTCTTGCCAGG - Intronic
1081739506 11:45428337-45428359 CCACAGAAACTGAACTGGCAGGG - Intergenic
1087081988 11:94179829-94179851 GCACTGAAACTGATCGGGCACGG - Exonic
1087744607 11:101929361-101929383 TCCCTGACACTGCTCTAGCAGGG + Intronic
1089456441 11:118628408-118628430 CCACTGAAGCTGCCCTTGTGGGG - Exonic
1092269775 12:7014263-7014285 CCACTGCTCCTGCCCTTGCAGGG + Intronic
1092977515 12:13759677-13759699 CCATTGAGCATGCTCTTGCAGGG - Intronic
1096420475 12:51452942-51452964 TCACTGAAACAGCTCTTGCTGGG + Intronic
1097361941 12:58668149-58668171 TCTCTGATACTGCTCTGGCAGGG + Intronic
1101124681 12:101619705-101619727 CTACTGAAAATGGTCTTGCCTGG + Intronic
1101730153 12:107420139-107420161 CCTCTGAAACTGCTCTCTCAGGG + Intronic
1102547828 12:113669575-113669597 CCCCAGAACCTGCTTTTGCATGG - Intergenic
1105272197 13:18887909-18887931 CCACTGCACCTGGTCTAGCATGG + Intergenic
1105767451 13:23575833-23575855 TCACTGAAACTATTCTTTCAGGG + Intronic
1106715340 13:32382570-32382592 CCACTGAAAGTGCTCCTCCACGG - Intronic
1110227124 13:73131415-73131437 CTTCTGAAACTGCTCCTTCAAGG + Intergenic
1112031280 13:95459009-95459031 CCACTGAATTTGGACTTGCATGG - Intronic
1112255985 13:97831626-97831648 CCGCTGACAATGCTCTTGCTGGG + Intergenic
1112450352 13:99501940-99501962 GCTCTGAAACAGCCCTTGCAAGG + Intronic
1115314689 14:32013616-32013638 CCACTGAAACTGCCCCCACAGGG - Intronic
1115399918 14:32945031-32945053 CCAAAGCAACTGCTCTTACAAGG - Intronic
1115976147 14:38999294-38999316 CCTCTGAAACTGCTCTGGTTTGG - Intergenic
1117062304 14:51975502-51975524 TCCCTGAAACTGCATTTGCAAGG - Intronic
1120735297 14:88045879-88045901 CCACTGAAACTGCCCCTGTAAGG + Intergenic
1120933043 14:89867550-89867572 CCAACGCAACTGCCCTTGCATGG + Intronic
1121472359 14:94165490-94165512 CTCATGAAACTGCTCTAGCAGGG - Intronic
1123459153 15:20452757-20452779 CCACTGACATTTCTCTCGCATGG + Intergenic
1123658907 15:22547661-22547683 CCACTGACATTTCTCTCGCATGG - Intergenic
1124312772 15:28642153-28642175 CCACTGACATTTCTCTCGCATGG - Intergenic
1126129648 15:45327851-45327873 CCATTTAAACTGCTCTGGTACGG - Intergenic
1126336357 15:47589768-47589790 CTACTGATGCTGCTCTTGTAAGG - Intronic
1130342729 15:83012865-83012887 CCACTAAAACTGCTGTAGCCCGG - Intergenic
1130750402 15:86705477-86705499 CCACGTAAAGTGTTCTTGCATGG + Intronic
1130759139 15:86799378-86799400 ACACAGAAATTGCCCTTGCAAGG + Intronic
1130893985 15:88156605-88156627 CCACTCACACTGTGCTTGCAGGG - Intronic
1130899167 15:88193993-88194015 CTACTGAAACTGCACTGTCAAGG + Intronic
1131972846 15:97909459-97909481 CCACTGTCACTGCACTTGCATGG - Intergenic
1135007758 16:18842341-18842363 ACACTGAAATTGCTCTTCCTGGG - Exonic
1135330816 16:21558240-21558262 CCACTGAAACGCCGCTTCCACGG - Intergenic
1137590452 16:49690161-49690183 CCACTGAAGCCTCTCTTGCATGG - Intronic
1140543746 16:75785861-75785883 CCACTCAGACTGCTCTTGCTTGG - Intergenic
1142043844 16:87912734-87912756 CCACTGAAACGCCGCTTCCACGG - Intronic
1144601566 17:16619676-16619698 CCACTGAAACTGCTCTAGTCAGG + Intergenic
1146954891 17:36931703-36931725 CCTCTGAAACTGATCTCCCAAGG + Intergenic
1146980835 17:37160025-37160047 CCACTGAAGCTGCTTTTGTCAGG - Intronic
1150560829 17:66293392-66293414 CCACTGACACTGTTCTGGCTGGG + Intergenic
1151958534 17:77392849-77392871 CCACTGACACTGCTGTTTCCTGG + Intronic
1152604222 17:81280977-81280999 CCAGAGCAGCTGCTCTTGCAAGG + Intronic
1153819946 18:8824604-8824626 TCACTGACACTTCTCATGCAGGG + Intronic
1154439276 18:14373231-14373253 TCACTGAAGCAGCTCTTGCTGGG - Intergenic
1156336773 18:36179593-36179615 CCACAAAGGCTGCTCTTGCAGGG + Intronic
1163574549 19:18103015-18103037 CCCCTGAAACTGCCCTTTAAAGG - Intronic
1167622430 19:50567429-50567451 CCACGGCAACCGCTCTTGCCAGG + Intronic
925038913 2:715060-715082 CCACTGGAACTGTTGTTACAAGG - Intergenic
928127519 2:28626698-28626720 CCAATGCACCTGCTCTTCCAGGG - Intronic
928499841 2:31879198-31879220 CCACTGAAACTGCTCTTGCAAGG + Intronic
929676380 2:43935823-43935845 CCACCGCACCTGGTCTTGCAAGG - Intronic
932067698 2:68583902-68583924 CCACTGAAACTGCTTTTGTCAGG + Intronic
934026418 2:88005281-88005303 CTACTTAAACTGCTCTTGTCTGG + Intergenic
934570166 2:95365521-95365543 CCAAGAAAACTGCTCTTACAAGG - Intronic
935493464 2:103748904-103748926 CCATTGACACTGCTCTGCCAAGG - Intergenic
935544528 2:104386853-104386875 ATACTGAAACTGCTCTTCCTAGG + Intergenic
937411267 2:121678559-121678581 CTACTGAAACTGTCTTTGCAGGG + Intergenic
937664978 2:124476516-124476538 TCTCTGAGACTGCTCCTGCAGGG + Intronic
938276791 2:130033381-130033403 ACACTGAAAGTTCTATTGCAGGG - Intergenic
938327757 2:130424162-130424184 GCACTGAAAGTTCTATTGCAGGG - Intergenic
938362188 2:130697316-130697338 GCACTGAAAGTTCTATTGCAGGG + Intergenic
938438599 2:131304014-131304036 ACACTGAAAGTTCTATTGCAGGG + Intronic
938644339 2:133315784-133315806 CCACTGAAACTGTTTTTGTCGGG - Intronic
943537621 2:189172061-189172083 CCACTTAAGCTGGTCTAGCATGG - Intronic
943928389 2:193818961-193818983 ACACTGAAGCTGCTGTGGCAGGG + Intergenic
944840293 2:203617870-203617892 CCTCTGAAACTCCTCTTCAAGGG - Intergenic
946975698 2:225147548-225147570 CTGCTGAAACTGCTCTTTCAAGG + Intergenic
949044825 2:241867555-241867577 CCACGTAAGCAGCTCTTGCAGGG + Intergenic
1168935914 20:1665182-1665204 CCACTGAGCCTGATGTTGCATGG + Intergenic
1170169544 20:13395063-13395085 CCTTAGAAACTGCTCTTGTATGG + Intronic
1171505806 20:25632541-25632563 CCACCGAAACTACTCTTGTCAGG + Intergenic
1175503009 20:59463648-59463670 CCAATGAGACTAGTCTTGCACGG - Intergenic
1175559525 20:59908980-59909002 TAAGTGAAACTGCTCTTTCATGG + Intronic
1176456405 21:6916177-6916199 TCACTGAAGCAGCTCTTGCTGGG + Intergenic
1176834580 21:13781237-13781259 TCACTGAAGCAGCTCTTGCTGGG + Intergenic
1177226211 21:18260358-18260380 CCAGTGAAACTTGTCTTGCCTGG + Intronic
1184552293 22:45210828-45210850 CCACTGAAACTGCTGCGCCAAGG + Intronic
952946277 3:38479593-38479615 CCACTGAGACTTCTCTGCCAGGG + Intronic
953832425 3:46312071-46312093 CCTTTGACACTGCTCTGGCAGGG + Intergenic
955167483 3:56528661-56528683 CCACTGAAACTGCTTTTGATTGG - Intergenic
955195261 3:56800255-56800277 CCACTCAAACTCCACTTGTAAGG - Intronic
961121214 3:124372895-124372917 CCATTGAAACCGCTCATCCAAGG - Intronic
963389021 3:144633289-144633311 CCTCTGACACTGCTCCAGCAGGG - Intergenic
964827685 3:160848320-160848342 GTACTGAAACTGCTCTTGCTGGG + Intronic
964827921 3:160850304-160850326 GTACTGAAACTGCTCTTGCTGGG - Intronic
967917157 3:194587287-194587309 CCACTGAAGCTGTACTTCCAGGG - Intergenic
970129304 4:12849340-12849362 CCACTAAAACTGCTTTAGCAAGG + Intergenic
970306541 4:14738340-14738362 TCACTGAAACTACTCTTTCAAGG + Intergenic
970701756 4:18749798-18749820 CCACTGAAACAGCTCTAGCAAGG + Intergenic
974682619 4:65182818-65182840 ACATTGAAACTGCTCTGGCCGGG - Intergenic
975223515 4:71841718-71841740 CCACCAAAACAGCTCTTACAAGG - Intergenic
977168582 4:93731304-93731326 CCACTGAATCTACTCTCCCAAGG - Intronic
977294194 4:95193026-95193048 CCACTGAAATCTCTCTTGAAGGG + Intronic
978555770 4:109979081-109979103 CCACTGGAACTGCTCTGAGAAGG - Intronic
980041867 4:127949078-127949100 GTCCTGAAACTGCTCTTGTAAGG - Intronic
980374591 4:131927982-131928004 CCCCTGCAACTGCTCTGGGAGGG + Intergenic
981112168 4:140947928-140947950 CCACTGCAAGTGCTTTTGTAAGG + Intronic
981296159 4:143134128-143134150 CCACTGAAACTGCACTCTCAGGG + Intergenic
981888602 4:149709819-149709841 CCACAGAAGCTGCTCCTGCAAGG + Intergenic
983021538 4:162682837-162682859 CCACTGATACTGCTTTTTCTGGG + Intergenic
985802812 5:2016862-2016884 CTCCTGAACCTCCTCTTGCAGGG - Intergenic
986406408 5:7429175-7429197 TCACTGTACCTGCTCTTTCAGGG - Intronic
987256322 5:16155899-16155921 CCTGTGAAACTGCACTTTCAGGG + Intronic
988467990 5:31509407-31509429 CCAGTGAAACTGCCCTTTTATGG - Intronic
990260774 5:54020243-54020265 CCGCTGACACTGCTCCTGTAAGG - Intronic
990941212 5:61204993-61205015 CCACTGGAACTGCTCTTGTCAGG + Intergenic
991208084 5:64073020-64073042 CCATTAAAACTGCTCTTGCTAGG - Intergenic
991328579 5:65465632-65465654 TCACTGAAACTGCTTTTGTCAGG + Intronic
992000666 5:72432854-72432876 CCAGTGAAACTTCTCTCCCAGGG - Intergenic
992273250 5:75087824-75087846 CCATAGAAACAGCTCTTCCAAGG - Intronic
992540829 5:77761977-77761999 CCACAGAAACTGATTCTGCATGG - Intronic
993897142 5:93549614-93549636 TCACTGAAAATTCTCATGCATGG - Intergenic
994103219 5:95916611-95916633 CCACTGAAACTGCTTCCCCAAGG - Intronic
996240874 5:121199761-121199783 ACACTGAATCTGCTGCTGCAAGG - Intergenic
996368611 5:122728984-122729006 CCCCTGAATCTGCTCTCCCAGGG + Intergenic
996369807 5:122741205-122741227 CTACTGAAACAGCTCTTGTCAGG + Intergenic
998714600 5:144868531-144868553 CCCCTGAAACTGCATCTGCAGGG - Intergenic
999925417 5:156370477-156370499 ACTCTGAAAATGCTCTTACATGG - Intronic
1000348682 5:160335470-160335492 CCACCCAAAATGCTCTTTCAAGG + Intronic
1002097407 5:176839622-176839644 CCCCTGAAACTGCCCTGGCAGGG + Intronic
1003467616 6:6396391-6396413 CCACTGAAAGTGCTTTTGCCAGG + Intergenic
1003509181 6:6765167-6765189 CCACTGAACCTGATCTTGTAAGG - Intergenic
1004149108 6:13098185-13098207 TTACTGAAACTGCTCTTGTAAGG + Intronic
1004534333 6:16485330-16485352 ACACTAAAACTTCTCATGCAAGG + Intronic
1004641909 6:17523747-17523769 CTCCAGAAACTGCTCTTGGAAGG - Intronic
1008360679 6:50613715-50613737 CCTCTGATACTTCTCTAGCAGGG - Intergenic
1008711630 6:54234668-54234690 CTACTGAAATTGCTCTGTCAAGG + Intronic
1010995288 6:82524947-82524969 CCACTGAATCATCTCTTGTAAGG - Intergenic
1012846343 6:104394281-104394303 CCACTGAAAGAGCTCTTGTAAGG - Intergenic
1013676656 6:112471364-112471386 CCAGGGTGACTGCTCTTGCAGGG - Intergenic
1014611287 6:123550473-123550495 CCACTGAAATTGCTCTTTGAAGG - Intronic
1015082088 6:129239450-129239472 CCACTGAAATTTCTATTGTAGGG - Intronic
1016307414 6:142698272-142698294 CCACTGAGCCAGCTCTTGCCTGG - Intergenic
1019953728 7:4395046-4395068 CAACTGATACTTCTCTTTCAAGG + Intergenic
1020148345 7:5662502-5662524 TCACTGAAACTGCTCTGGGTCGG + Intronic
1020472121 7:8549845-8549867 GCACTGAAACTGGGCTTCCAGGG - Intronic
1022003679 7:26248204-26248226 GGACAGAAACTGGTCTTGCACGG - Intergenic
1022162164 7:27721980-27722002 TCACTGAAAATGCTTTTGCAGGG + Intergenic
1025088672 7:56044227-56044249 CCACTGTGCCTGGTCTTGCATGG + Intronic
1025605765 7:63038925-63038947 CCACTGAAACTGCACTGGCGAGG - Intergenic
1026273225 7:68854261-68854283 CCAATGAAGCTGCTCTCACAGGG + Intergenic
1026312620 7:69200392-69200414 CCACTGACACTGCTGCTGAATGG - Intergenic
1027879549 7:83816959-83816981 CCATTGAAACTTCTTTTACAAGG + Intergenic
1030161918 7:106518011-106518033 CCACAGAAACAGCTTTTGCAAGG + Intergenic
1030302291 7:107986523-107986545 CCACAGAGACTCTTCTTGCAAGG + Intronic
1032535669 7:132661505-132661527 CCAAGGAAACTGCACCTGCAAGG - Exonic
1033470189 7:141640243-141640265 CCATTGAAACAGCTCCTTCAGGG + Intronic
1034621726 7:152462298-152462320 GCACTGAAACTGCTCCTGTAAGG + Intergenic
1034960684 7:155362545-155362567 CCACCGAGACAGCTCATGCATGG + Intronic
1035242398 7:157540771-157540793 GAACTCAAACTGCTCCTGCAGGG + Exonic
1035254120 7:157615284-157615306 CCACGCACACCGCTCTTGCAGGG - Intronic
1036779183 8:11634059-11634081 CCACTGAAACTGCACTGGCAAGG + Intergenic
1039234060 8:35482534-35482556 CCACTGAAAATCCTCTTATATGG + Intronic
1039854291 8:41399020-41399042 CCACTGAAACTTATCTTGTAAGG + Intergenic
1040348777 8:46540945-46540967 CCTCTGAAACTGCTTTTTGATGG + Intergenic
1040584239 8:48725290-48725312 CCCCTGAATCTGCTATTGCAAGG - Intronic
1040738388 8:50539707-50539729 CCACTGACACTACCCTGGCAGGG + Intronic
1040799485 8:51325335-51325357 CCTCTGAAACTGCTCTGGCATGG + Intronic
1041325559 8:56659690-56659712 CCACTGAAACTGCCCTGGAGAGG + Intergenic
1041524358 8:58788998-58789020 CCACTGCACCTGGCCTTGCAAGG + Intergenic
1041811231 8:61912993-61913015 CCACTGCAACTGTTCTCTCAAGG + Intergenic
1042948097 8:74174933-74174955 CCATTGAAACTGCTTTTGCAAGG - Intergenic
1043764561 8:84114110-84114132 TCACTGCAACTGCACTTCCAAGG + Intergenic
1045259100 8:100556663-100556685 CTCCTGAAAGTGCTCTTGCAAGG + Intronic
1045802998 8:106123228-106123250 CCAGTGTGACAGCTCTTGCATGG + Intergenic
1046333423 8:112752054-112752076 CCATGGAAACTGCTGTTGTAAGG + Intronic
1048889531 8:138935218-138935240 CCACTCAATCTTCTCTTGGAAGG + Intergenic
1051173773 9:14344708-14344730 CCACTGAACCTCCTCCTACAGGG + Intronic
1052505123 9:29343714-29343736 CCTCTGAAATTGCTCTTGCAGGG + Intergenic
1052759027 9:32570473-32570495 TCACTGATACAGATCTTGCATGG - Intronic
1053236768 9:36462182-36462204 TCCCTGAAACTGCTCTGCCAAGG - Intronic
1055240178 9:74174565-74174587 CCACTGTTCCTCCTCTTGCAGGG + Intergenic
1056104464 9:83333212-83333234 CCCCTGAAGCTGTCCTTGCAAGG + Intronic
1059095450 9:111408590-111408612 CACCAGAAACTCCTCTTGCAAGG - Exonic
1059308908 9:113375181-113375203 CCATTGAAACTTGACTTGCAGGG - Intronic
1061074677 9:128333870-128333892 CGACTGATACTGTTCATGCATGG - Exonic
1061324646 9:129856226-129856248 GCACTGAGACTGCTCCTGCCTGG - Intronic
1061651779 9:132056238-132056260 CAACAGACACTGCTCATGCAAGG + Intronic
1062233874 9:135498874-135498896 CCACTGTCCCTGCTCTTCCAAGG + Intronic
1186485537 X:9932015-9932037 CCACCGCAACTCCTCATGCAAGG - Intronic
1186808591 X:13164518-13164540 CCAGTAAATCTGCTTTTGCATGG + Intergenic
1188288142 X:28354880-28354902 CCATTTAAACTGCTCTTGGCCGG + Intergenic
1189943525 X:46152969-46152991 CCACTTACACTCCTCTGGCAGGG + Intergenic
1190641335 X:52484088-52484110 CCACAGAAACTCCCCTTGCATGG + Intergenic
1190646337 X:52528777-52528799 CCACAGAAACTCCCCTTGCATGG - Intergenic
1192087525 X:68115633-68115655 CCAATGAAGCTGCTTTTGCCAGG - Intronic
1194819319 X:98486685-98486707 CCACTGAAACTGCTGTTTCAAGG - Intergenic
1199406944 X:147473294-147473316 CCACTGAAGCTCCTTTTGCCTGG - Intergenic
1199707574 X:150444030-150444052 CCTCTGACACTGCTCTGGCAGGG + Intronic
1199945842 X:152666270-152666292 CCTCTGACACTGCTCTAGCAGGG - Intergenic
1200252279 X:154559993-154560015 CCACTGAGACTGCTTTTGCTGGG + Intronic
1200265489 X:154644423-154644445 CCACTGAGACTGCTTTTGCTGGG - Intergenic
1200326711 X:155248201-155248223 CCACAGAAACTGCTCTTGTCAGG + Intergenic
1202335811 Y:23809880-23809902 CCACTGAAACTTCTAGTACAGGG + Intergenic
1202534956 Y:25860187-25860209 CCACTGAAACTTCTAGTACAGGG - Intergenic
1202603896 Y:26622333-26622355 ACACTGAAACTGCCCATGAATGG + Intergenic