ID: 928504994

View in Genome Browser
Species Human (GRCh38)
Location 2:31941911-31941933
Sequence ATTCTGATATTGATTAAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 484}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928504992_928504994 27 Left 928504992 2:31941861-31941883 CCTACCATTAATAGTAGGCTCTT 0: 1
1: 0
2: 0
3: 3
4: 72
Right 928504994 2:31941911-31941933 ATTCTGATATTGATTAAAAACGG 0: 1
1: 0
2: 2
3: 37
4: 484
928504993_928504994 23 Left 928504993 2:31941865-31941887 CCATTAATAGTAGGCTCTTTATG 0: 1
1: 0
2: 0
3: 10
4: 112
Right 928504994 2:31941911-31941933 ATTCTGATATTGATTAAAAACGG 0: 1
1: 0
2: 2
3: 37
4: 484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928504994 Original CRISPR ATTCTGATATTGATTAAAAA CGG Intronic
900075570 1:814040-814062 AGTTTGATATTGATTATGAAAGG + Intergenic
903115239 1:21173919-21173941 AATGGGGTATTGATTAAAAAAGG - Intronic
904211729 1:28890339-28890361 ATTCTGATATTTATTAAAGGGGG + Intronic
905460474 1:38119471-38119493 ATAAAAATATTGATTAAAAATGG + Intergenic
907837139 1:58120741-58120763 TTTTAGATTTTGATTAAAAAGGG - Intronic
907839882 1:58146707-58146729 ATTCTGTTATATATTATAAATGG - Intronic
908013239 1:59804756-59804778 ATTCTGATAATAATTATTAATGG + Intergenic
908594252 1:65669408-65669430 ATTCTAATGTTGAATAAAAGTGG + Intergenic
908674546 1:66589042-66589064 AATTTAATATTGATTAAAACAGG - Intronic
909016051 1:70380772-70380794 TTACTGATATTAATTTAAAAAGG + Intronic
909083351 1:71142491-71142513 AGTATGATGTTGAATAAAAATGG + Intergenic
909707165 1:78599393-78599415 AATCTCATATTGATTTAAAAAGG + Intergenic
910052040 1:82986212-82986234 ATTCTGATTCTAATTAAAAAGGG + Intergenic
911133696 1:94417759-94417781 ATTCTCAATTTTATTAAAAACGG + Intergenic
911450817 1:98058208-98058230 ATTGTGAGATGCATTAAAAACGG + Intergenic
911618027 1:100036584-100036606 ATTTTCATACTGACTAAAAATGG - Intergenic
911622883 1:100086927-100086949 ATTTTGATCTTTTTTAAAAATGG + Intronic
911876469 1:103170190-103170212 CTTCTGATTTTAATAAAAAATGG + Intergenic
912213497 1:107580765-107580787 ATTCTGATATTGCTTACATCTGG - Intronic
917251609 1:173068751-173068773 ATTATGTCAATGATTAAAAATGG - Intergenic
917588170 1:176449610-176449632 TATCTGATATTGATAATAAAGGG - Intergenic
917613461 1:176713901-176713923 ACTCTTATATTGCTTAAAAGAGG + Intronic
918230182 1:182522549-182522571 ATTCTCAGATTGATTATAAGTGG - Intronic
919032719 1:192264954-192264976 ATTAGGAAATGGATTAAAAATGG - Intergenic
919417270 1:197326722-197326744 ATTATGAAATTGAATTAAAAAGG - Intronic
919754840 1:201060227-201060249 ATTATGATATTGTCTATAAAGGG + Intronic
921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG + Intronic
921452127 1:215321654-215321676 ATTTTGATATTGCTGACAAAGGG + Intergenic
921493630 1:215809690-215809712 ATTAGCATATTTATTAAAAAAGG + Intronic
922271412 1:224038914-224038936 AGTTTGATATTGATTATGAAAGG + Intergenic
922294698 1:224239614-224239636 ATTCAGCTTTTGATTAAAACAGG - Intronic
923787626 1:237083462-237083484 ATTCTGCAATTTATCAAAAAAGG - Intronic
923970424 1:239196326-239196348 ATTCTGATATGAGATAAAAAGGG - Intergenic
924306968 1:242699455-242699477 AACCTGATTTTAATTAAAAAAGG + Intergenic
924449813 1:244167444-244167466 ATACTGATATTAGTAAAAAATGG + Intergenic
924856140 1:247876853-247876875 ATTCTTAAATTGATTCAGAATGG + Exonic
1063703380 10:8407546-8407568 ACTCTGCTATTGACTAAACAAGG - Intergenic
1063910480 10:10824664-10824686 TTTCTGACATTGCTTAAGAAAGG - Intergenic
1064438936 10:15335830-15335852 TTTCTAATACAGATTAAAAAGGG + Intronic
1065476876 10:26147912-26147934 GCTCTCTTATTGATTAAAAATGG + Intronic
1065550152 10:26861402-26861424 ATTCAGAGAAGGATTAAAAAGGG + Intergenic
1067339181 10:45387410-45387432 ATTCTTATACTGAGCAAAAACGG - Intronic
1067914188 10:50378805-50378827 GTTTTGATATTCCTTAAAAATGG - Intronic
1071058073 10:81534335-81534357 TTTCTGATAGTGTTGAAAAATGG + Intergenic
1072172205 10:92875858-92875880 ATTTTTATTTTGATAAAAAAGGG - Intronic
1072948182 10:99829451-99829473 ATTAGAATAATGATTAAAAATGG - Intronic
1073813241 10:107174797-107174819 AATATGATATTGAATAGAAATGG + Intergenic
1075160075 10:120015930-120015952 ATTCTGATATTTAATATAAATGG + Intergenic
1076945271 10:133643671-133643693 AATCTGATTTTGAGTACAAAAGG + Intergenic
1077599099 11:3560943-3560965 ATTCTGACTTTGATTCTAAAGGG + Intergenic
1079613362 11:22460564-22460586 ATTTTGATATTCATCAAACATGG + Intergenic
1079697735 11:23504118-23504140 AGTCTGATAGAGATTAAATAGGG + Intergenic
1080174595 11:29346911-29346933 ATTCTGCAATTGATTAACAGAGG + Intergenic
1080183570 11:29452571-29452593 AATCTGAAATTTCTTAAAAATGG + Intergenic
1080840458 11:35978942-35978964 ATTCTGGTATTCACTAATAAGGG - Intronic
1080957921 11:37123104-37123126 ATTTTGTCATAGATTAAAAACGG + Intergenic
1081302512 11:41469557-41469579 ATACTGAATTTGATTAAATAAGG - Intergenic
1082191593 11:49251749-49251771 ACTTGGATGTTGATTAAAAAGGG - Intergenic
1083247351 11:61439491-61439513 ATTCTGTTATCGATGAAAACTGG + Intronic
1086077958 11:82874741-82874763 ATTCTGATAGAGAATAAAAGAGG + Intronic
1086154029 11:83646270-83646292 ATTCAGATAGTGACTCAAAATGG - Intronic
1086303139 11:85451591-85451613 ATTTTGACATTTATTAAATAAGG + Intronic
1086668197 11:89511634-89511656 AATCTGATATTATTTAAAAGAGG - Intergenic
1086674531 11:89589269-89589291 ACTTGGATGTTGATTAAAAAGGG + Intergenic
1087824823 11:102753403-102753425 ATTTTGATAATGATGAAACAAGG - Intergenic
1088063143 11:105681685-105681707 ATTTTTATATTGATTACATATGG + Intronic
1088147334 11:106697732-106697754 ATTCTGAGAGTGAATAAATATGG + Intronic
1088671845 11:112148962-112148984 ATAATGATATAGATTATAAAAGG - Intronic
1088836386 11:113581000-113581022 ATTCAGTTATGGATTAAAAGGGG - Intergenic
1089415020 11:118281332-118281354 ATTCTGATGCTCACTAAAAATGG - Intergenic
1089897571 11:121947008-121947030 ATTCTGATTTGAATTAAAACAGG - Intergenic
1090520776 11:127476597-127476619 ATTCTGAGTCTGATTAAAACAGG + Intergenic
1091144969 11:133271200-133271222 ATTTTTATAGAGATTAAAAAGGG + Intronic
1091866331 12:3840365-3840387 ATTCTGATATGGATTACAGAGGG + Intronic
1092087284 12:5773591-5773613 ATTCAGTTATGGATTAGAAAAGG + Intronic
1092220917 12:6712822-6712844 ATTCAAATATTGATGAAAACTGG - Intergenic
1092570155 12:9712576-9712598 ATTGTGATATTCAATAAAAGTGG + Intergenic
1092955535 12:13546111-13546133 ATTCCAATATTGAAAAAAAAAGG + Exonic
1093078807 12:14786118-14786140 ATTCTTTTATAGCTTAAAAATGG + Exonic
1093119558 12:15252301-15252323 AATGTGATATTTATAAAAAATGG + Intronic
1093550085 12:20399299-20399321 ATTTTTATATTGTTTAAAAGTGG + Intronic
1093841124 12:23901937-23901959 ATGCTGAAATTATTTAAAAAAGG - Intronic
1093854396 12:24082517-24082539 ATTTTGATTTTAATTAAGAATGG + Intergenic
1093859712 12:24149067-24149089 ATGCTAATATTGATTCAAAATGG + Intergenic
1094104003 12:26789437-26789459 ATTCTCATAATGGTGAAAAACGG - Intronic
1095370143 12:41457545-41457567 ATTCTGCTATAGCTAAAAAAAGG - Intronic
1095842425 12:46708152-46708174 ATTGTCAAATTGAATAAAAAGGG - Intergenic
1098619322 12:72573709-72573731 ATTCTAATGTTGATTTGAAAGGG - Intronic
1098657375 12:73050159-73050181 ATTCTCTGATGGATTAAAAATGG + Intergenic
1098814062 12:75134991-75135013 GATCTGATATTGATTATGAATGG - Intronic
1099335327 12:81348902-81348924 ATTTTGTTCTTGATTACAAATGG + Intronic
1099465336 12:82979169-82979191 ATTATAATATTGAATATAAATGG - Intronic
1099754629 12:86829052-86829074 TTTCAGATATTAATAAAAAATGG + Intronic
1100151942 12:91749343-91749365 ATATTGATAATGATTAAAATAGG - Intergenic
1100818927 12:98412940-98412962 ATTCCAATAATGATGAAAAAAGG - Intergenic
1101397495 12:104361327-104361349 ATTCTGAGATTAATTTCAAAAGG - Intergenic
1102066990 12:109985399-109985421 ATTCTGCTGGGGATTAAAAAAGG + Intronic
1102633521 12:114302416-114302438 TTTCTGATAAGGAGTAAAAATGG - Intergenic
1104511355 12:129382249-129382271 CTTCTAATCTTGATTAAAATGGG - Intronic
1105201299 13:18182051-18182073 ATTCTGACATTTATGATAAATGG - Intergenic
1107149540 13:37095651-37095673 AATATGAGATTGAATAAAAAGGG - Intergenic
1107368854 13:39718936-39718958 ATTTTAATATGGATTTAAAATGG - Intronic
1107575736 13:41719936-41719958 ATTCTGGCATTTATTTAAAAAGG - Intronic
1108928530 13:55785474-55785496 ATTCTAATTTTGATCATAAATGG + Intergenic
1109589689 13:64462523-64462545 ATTCTGATATGGACAAAAACAGG + Intergenic
1109653269 13:65355536-65355558 ATCCTGAAATTTTTTAAAAAAGG + Intergenic
1109656053 13:65391245-65391267 ATTTTGATAGGCATTAAAAAGGG - Intergenic
1109878184 13:68432504-68432526 ATTATAAAATTGATTAGAAAGGG - Intergenic
1109966340 13:69702595-69702617 ATTATCTTATTGATTGAAAAAGG + Intronic
1110757295 13:79190276-79190298 ATTTATATATTGATTAACAAAGG - Intergenic
1111216824 13:85154234-85154256 ATTTGGAAATTGATTAGAAATGG - Intergenic
1111336086 13:86825401-86825423 ATTCTAATATTTACTAAGAATGG - Intergenic
1111383997 13:87499477-87499499 ATCCAGTGATTGATTAAAAAAGG - Intergenic
1111568744 13:90049929-90049951 ATTCTGCTATTATTTATAAAAGG - Intergenic
1111576420 13:90160352-90160374 ATTCTGAATTTGAGGAAAAATGG - Intergenic
1111781638 13:92734654-92734676 ATTGTGATGTTTATTAAATATGG + Intronic
1111822937 13:93235314-93235336 AATCTGATATTGAATAGATAGGG + Intronic
1111930382 13:94506834-94506856 ATCCTGTTATTCACTAAAAAGGG + Intergenic
1112187369 13:97140197-97140219 ATTCTTAAGTTGAGTAAAAATGG - Intergenic
1112538955 13:100287871-100287893 ATTCTTAGATGGATTAAATAAGG + Intronic
1112693489 13:101920626-101920648 ATTTTGATATTGAAAAAACATGG - Intronic
1112839187 13:103554641-103554663 ACTCTGATACTCATAAAAAACGG + Intergenic
1112887912 13:104196424-104196446 TTTCTGATATAGATAGAAAAGGG + Intergenic
1114947051 14:27696370-27696392 ATTTTTAAACTGATTAAAAAGGG - Intergenic
1115413262 14:33100829-33100851 TTTCTGCTATTGCTTATAAATGG + Intronic
1115918165 14:38341322-38341344 AATGTGATATTGACTAAAAGTGG + Intergenic
1116116728 14:40662125-40662147 ATTCTTAAATTGATTTTAAAAGG - Intergenic
1116391715 14:44399618-44399640 AATCTGATAATCATTAAAATAGG + Intergenic
1116684912 14:48026828-48026850 ATACAGATATCCATTAAAAATGG - Intergenic
1117126007 14:52626610-52626632 ATTGGAATATTGAATAAAAATGG - Intronic
1117168960 14:53070317-53070339 GTTCTGATATTAACTATAAACGG - Intronic
1117853452 14:60001440-60001462 AATATGATATTGAACAAAAAAGG + Intronic
1118670886 14:68125494-68125516 AATCTGATATTGCTTAGAACTGG + Intronic
1119923273 14:78467433-78467455 ATTTTCATATTGATTACAAATGG - Intronic
1119937392 14:78604550-78604572 ATTCTCATGTTGATTATAAATGG + Intronic
1120615755 14:86701833-86701855 ATTTTAATTTTTATTAAAAAGGG - Intergenic
1122655622 14:103257557-103257579 ATTATAATTTTGTTTAAAAATGG + Intergenic
1202904941 14_GL000194v1_random:64498-64520 TTTCTGATTTAGATTATAAAAGG - Intergenic
1202926015 14_KI270724v1_random:25572-25594 AATCTGATTTTGAGTACAAAAGG - Intergenic
1124932833 15:34138782-34138804 ATTCTGTTATAGAATAAAAAAGG + Intergenic
1124953090 15:34341442-34341464 AATAAGATTTTGATTAAAAATGG - Intergenic
1126405632 15:48319883-48319905 AGTCTTACAATGATTAAAAAGGG + Intergenic
1127061344 15:55189256-55189278 ATTCTTAAATTGATTTCAAAAGG - Intronic
1127090228 15:55459504-55459526 ATACTGATATTGAATGTAAATGG + Intronic
1127162414 15:56203384-56203406 ATTTTAATATTGTTTAAAATTGG + Intronic
1127342313 15:58060234-58060256 ATTCTGATCTTCCTTAAAATTGG + Intronic
1128846439 15:70901267-70901289 AATATGACATTGATGAAAAATGG + Intronic
1128881686 15:71248796-71248818 AGTCTGATATTGAATGAAAGAGG + Intronic
1130572882 15:85064456-85064478 ATGCTGATTTTCTTTAAAAAGGG + Intronic
1131706726 15:95004471-95004493 ATTATGATAGGGATTAAACAAGG + Intergenic
1132192186 15:99875307-99875329 ATTCAGACATTGATTAAGAGAGG - Intergenic
1142798435 17:2327942-2327964 ATTCTTTTATTGTTTCAAAATGG - Intronic
1143679553 17:8466167-8466189 ATTTGGAAAATGATTAAAAAAGG + Intronic
1146148852 17:30448797-30448819 ATATTAATTTTGATTAAAAAGGG + Intronic
1146566983 17:33921936-33921958 ATGCTGAAAATGATTAACAATGG + Intronic
1147505068 17:41007990-41008012 ATGCTAACATTAATTAAAAATGG + Intergenic
1149464567 17:56866819-56866841 ATTCTGCTATTTTTTATAAAGGG + Exonic
1151011644 17:70505052-70505074 ATTTTCACATTGCTTAAAAATGG - Intergenic
1151120632 17:71788936-71788958 ATTGTGGAAATGATTAAAAAGGG + Intergenic
1151865213 17:76797359-76797381 ATCCCTATATTGCTTAAAAAGGG - Intergenic
1153099960 18:1456091-1456113 AGTCTTATATTGAATAACAATGG - Intergenic
1153191785 18:2548862-2548884 ATTGTGATACTGATTTAAGATGG - Intronic
1154002788 18:10498152-10498174 TTTCTTATAATGATTAAAGACGG + Intergenic
1154991016 18:21598739-21598761 ATTATAATATTGATTGAGAAAGG + Intronic
1155659707 18:28233561-28233583 ATTTTGATTTTGATTAATAAAGG - Intergenic
1155848406 18:30737930-30737952 ATTCTGATATTAATTAAAATTGG - Intergenic
1156145905 18:34177535-34177557 GTTCTGATATTCAGCAAAAAGGG - Intronic
1156417535 18:36912951-36912973 ATTATGAAATTGACTAAAACAGG - Intronic
1156644911 18:39149039-39149061 ACTCTCATATTGCTTAAAAAAGG - Intergenic
1156693046 18:39731708-39731730 AATCTGACATTCCTTAAAAATGG - Intergenic
1156791528 18:40980561-40980583 ATTCTGAAAATGATCAAATAGGG + Intergenic
1157011176 18:43650811-43650833 ATTATGCAATTTATTAAAAATGG - Intergenic
1157376393 18:47170908-47170930 ATTATGATGTTAAATAAAAATGG + Intronic
1157935315 18:51865474-51865496 ATTCTGACATAGATTCCAAATGG - Intergenic
1158207947 18:55014547-55014569 TTTCTGATATTGAGGAAAATAGG - Intergenic
1158429446 18:57372041-57372063 ATGGAGATATTGATTAAAAGAGG - Intergenic
1158734080 18:60060037-60060059 ATTCTAAAATTGATCTAAAATGG - Intergenic
1158839953 18:61374652-61374674 ACTCTGAAAGTGTTTAAAAATGG - Intronic
1159042725 18:63340156-63340178 ATTCTGATGTTGATTAAGTTGGG - Intronic
1160385969 18:78496627-78496649 TTTATGATATTGTTTATAAAAGG + Intergenic
1162712590 19:12606867-12606889 ATTGAAATATTGAATAAAAATGG - Intronic
1164796263 19:31034406-31034428 ATTATGAAATTTATTTAAAAAGG - Intergenic
1166018030 19:39997839-39997861 ATTCTGCTATTCATCAAAACAGG + Exonic
925240416 2:2320984-2321006 ATTAGGAAGTTGATTAAAAAGGG - Intronic
925352596 2:3211946-3211968 GTTCTGCTAATGATTATAAATGG + Intronic
925417651 2:3682443-3682465 ATTCTGTTTTTTATTAAACATGG + Intronic
926660279 2:15458126-15458148 ACTCGGATATTTATTAAAGAAGG + Intronic
927555856 2:24031495-24031517 ATTCTAATATGGAGTAAACATGG - Intronic
927958965 2:27227985-27228007 ATTTTGAGATTTGTTAAAAAAGG - Intronic
928504994 2:31941911-31941933 ATTCTGATATTGATTAAAAACGG + Intronic
928506413 2:31958148-31958170 GTTCTGATATTGATAAATTAGGG + Intronic
928560384 2:32477993-32478015 TTTCTTATATTAATTAAAATAGG + Intronic
928772074 2:34714723-34714745 TTTGTGACATTCATTAAAAATGG - Intergenic
929928518 2:46234351-46234373 AATCAGATACTGATTGAAAACGG - Intergenic
930472338 2:51834022-51834044 ATTCTGAGTTTGTTTAGAAAAGG + Intergenic
930796163 2:55393903-55393925 ATTCAGACATTGAATAGAAATGG - Intronic
931612281 2:64114974-64114996 ATACTGATACTGATAATAAAAGG + Intronic
933409019 2:81901239-81901261 AGTATGATATTGACTAGAAAGGG - Intergenic
933434656 2:82232937-82232959 TTTCTATTATTTATTAAAAATGG - Intergenic
933670403 2:85001804-85001826 ATTATGAAATTGTTTAACAATGG - Intronic
934027521 2:88013635-88013657 ATGCTGAAATTTATCAAAAAGGG + Intergenic
934997028 2:98973355-98973377 GTTCTGATACTGATTAGGAAAGG - Intergenic
936479688 2:112874547-112874569 ATTCTTACATTGTTTAAAAATGG - Intergenic
936896230 2:117430933-117430955 TTTCTGATTTTCATTAGAAAAGG + Intergenic
936990442 2:118359049-118359071 AATATGATATTGAATAAAAGTGG + Intergenic
937508310 2:122562216-122562238 ATTATGAAATATATTAAAAATGG + Intergenic
937661994 2:124441064-124441086 TTTCTGCTCTTCATTAAAAAAGG - Intronic
937748871 2:125449385-125449407 ATTGTGATATTCAATGAAAAAGG - Intergenic
939283445 2:140096144-140096166 ATCATGATATTAATTATAAATGG - Intergenic
939704306 2:145432712-145432734 CTTCTGAAATTGTTTAAATATGG - Intergenic
939765660 2:146246058-146246080 ATTATGAGATTTATGAAAAAGGG - Intergenic
940635294 2:156292022-156292044 ATTCTGATAAAGATTAAACATGG - Intergenic
941094633 2:161223523-161223545 CTTTTGATATTCAGTAAAAATGG - Intronic
941413693 2:165192180-165192202 ATTTTGATTTAGATTAAATAAGG - Intronic
941419236 2:165261551-165261573 TTTCTGAAAGTGATTTAAAAAGG - Intronic
941600761 2:167540987-167541009 ATTCTGAAATTACTTTAAAATGG + Intergenic
942851843 2:180496156-180496178 ATTCTACTATGTATTAAAAATGG - Intergenic
943235517 2:185313658-185313680 ATGCTAATTTTGATTAAAAGAGG - Intergenic
943300928 2:186198642-186198664 ATGCTGAAAGTTATTAAAAATGG - Intergenic
943721721 2:191210634-191210656 ATTATGATATTAATTAGAAATGG + Intergenic
944043809 2:195386207-195386229 AATCTGACATTGCTGAAAAATGG - Intergenic
945773262 2:214072567-214072589 AATCTGCTATTGAATAAAATTGG + Intronic
946040918 2:216781989-216782011 ACTCTGACATTGGTTGAAAACGG + Intergenic
946631441 2:221673551-221673573 TTTCTGATATGGATGTAAAATGG + Intergenic
947358839 2:229325825-229325847 ATTTTCATATTGGATAAAAAAGG + Intergenic
947448466 2:230183001-230183023 ACTTTGATAATGAATAAAAAGGG + Intronic
947561579 2:231158496-231158518 ATTCTGAGATTTAATAAATAAGG - Intronic
948510460 2:238460635-238460657 TTTCTGATTTAGTTTAAAAAAGG + Intergenic
949082153 2:242110761-242110783 AGTTTGATATTGATTATGAAAGG - Intergenic
1168898088 20:1337777-1337799 ATTATGATAGAGATTAAAAGGGG - Intronic
1170132133 20:13032207-13032229 ATTCTGATCTTGTTTATAACTGG - Intronic
1170741234 20:19058582-19058604 ATACTAATATTGAATATAAATGG + Intergenic
1170848648 20:19983597-19983619 ATTCTGATTTTTTTTTAAAAAGG - Intronic
1171102185 20:22394494-22394516 ATTCTGATACTTATCAGAAAGGG + Intergenic
1172160092 20:32861750-32861772 ATTTTTATTTTAATTAAAAAAGG - Intronic
1172656097 20:36539420-36539442 ATTCTGATATACACTAAACATGG + Intergenic
1173064429 20:39696885-39696907 ATTGTGATTATGTTTAAAAAAGG + Intergenic
1176624303 21:9079256-9079278 TTTCTGATTTAGATTATAAAAGG - Intergenic
1176716647 21:10355942-10355964 ATTCTGACATTTATGATAAATGG + Intergenic
1177176885 21:17709083-17709105 ATTCTGATATTTTCTATAAATGG + Intergenic
1177330887 21:19660631-19660653 ATACTGATATTGAATGTAAATGG + Intergenic
1177701954 21:24650828-24650850 ATTCTGATATGGTTTGAATATGG + Intergenic
1178302686 21:31466107-31466129 ATTCTGACATTTTTTACAAATGG + Intronic
1179103833 21:38380649-38380671 ATTCTTAAATTGTTTCAAAATGG - Exonic
1179728044 21:43351136-43351158 ATTTTGATAGTGAGGAAAAAAGG - Intergenic
1180572238 22:16737255-16737277 ATTCTTATTATGATTAAAAATGG - Intergenic
1180601690 22:17024007-17024029 ATTCTGACATTTATGATAAATGG - Intergenic
1182573568 22:31257606-31257628 ATTCAAATTTAGATTAAAAAAGG - Intronic
1182938405 22:34249367-34249389 GTTGTGATATTGACTAGAAAAGG - Intergenic
1183173185 22:36202928-36202950 ACTCTGCTATTGAAGAAAAACGG + Intronic
1183255553 22:36759293-36759315 ATTCTGAACTTGATTTAAAGTGG - Intronic
1183767174 22:39888884-39888906 ATTCTGAGAGTAATTAAAATGGG + Intronic
1183905981 22:41040538-41040560 ATTCTGACATTGACTGAACATGG + Intergenic
1184962361 22:47940730-47940752 CTTCTGCTATTGATTTAAAGTGG - Intergenic
949726142 3:7047578-7047600 TTTCAGAAGTTGATTAAAAATGG + Intronic
951327127 3:21315996-21316018 ATTCTGATATTAGTCAAAACAGG - Intergenic
951800399 3:26589442-26589464 ATTCTCATAGTGATCATAAAGGG + Intergenic
952647184 3:35674675-35674697 ATTCTGATAGCTATGAAAAATGG + Intronic
953332949 3:42069724-42069746 ATACTGATTTTGATTAAATAAGG - Intronic
953758911 3:45671646-45671668 ATTCTGATATATATTAAAGTTGG - Intronic
955761511 3:62289158-62289180 ATTCTGAGGTTGAATAAATAAGG - Intronic
955845436 3:63158031-63158053 GTTCTGATATTTATTATTAAGGG - Intergenic
956175383 3:66468361-66468383 ATTCTGTTAATGTTGAAAAATGG - Intronic
956877061 3:73474413-73474435 ATTATCTTATTCATTAAAAAAGG + Intronic
957315960 3:78577217-78577239 ATTTTGATACTGATTACAAATGG + Intergenic
957415721 3:79900918-79900940 ATTCTGTTTTTTATTAATAATGG - Intergenic
957516761 3:81264450-81264472 ATTCTGATGTTTATTAAGTATGG + Intergenic
957615056 3:82516498-82516520 CTTCTGATAATGATGGAAAAGGG + Intergenic
957656151 3:83079145-83079167 ATTCTTCAATTGATTCAAAATGG + Intergenic
958543566 3:95510943-95510965 AATCTGATAGTTATAAAAAAGGG + Intergenic
959013482 3:101106799-101106821 ATTCTGATTCTTAGTAAAAATGG - Intergenic
959067701 3:101675325-101675347 ATTCAGATATTGGTTTAAAGTGG + Intronic
961995848 3:131241974-131241996 ATTTTGACATTGTCTAAAAAGGG + Intronic
962034623 3:131638193-131638215 ATACTAATATTGAATATAAATGG + Intronic
962918621 3:139931722-139931744 AATCTGATTATGATTAAATAGGG + Intergenic
963203651 3:142610573-142610595 ATTCTAATATTGTCTTAAAATGG + Intronic
963914769 3:150848870-150848892 ATTTTAATAGTTATTAAAAACGG - Intergenic
964436877 3:156662848-156662870 CTTCTGATATTAATGAATAAGGG - Intergenic
964439641 3:156693808-156693830 ATTTTGGTCTTGATTAGAAAGGG + Intronic
965202911 3:165683102-165683124 ATTCAGGTATTGATGAACAATGG + Intergenic
965208004 3:165746684-165746706 ATTCTCAAATTGAATAAATAAGG + Intergenic
965264814 3:166529519-166529541 TTTATAACATTGATTAAAAATGG + Intergenic
965711558 3:171560752-171560774 ATACTCATATTTAGTAAAAAAGG - Intergenic
965716500 3:171610360-171610382 ATTCTAATTTTGTTTTAAAAAGG + Intronic
968011265 3:195279312-195279334 ATTCTGAATTTTTTTAAAAATGG - Exonic
968209087 3:196832890-196832912 ATTCTGAACTTGATTTAGAAAGG - Intergenic
969960104 4:10936050-10936072 ATTCAGTTAGTGATTAAACACGG - Intergenic
970030185 4:11665459-11665481 ATCCTGAGATTAATTACAAAGGG + Intergenic
970712857 4:18884509-18884531 ATTCTGACATTTCTTATAAATGG - Intergenic
971145530 4:23971961-23971983 ATTATGTATTTGATTAAAAATGG - Intergenic
971907106 4:32740492-32740514 ATTTTTATATTGATTACATATGG + Intergenic
971928488 4:33047091-33047113 CCCCTGATATTGAATAAAAATGG + Intergenic
972223012 4:36977775-36977797 ATTCTTATATTCAATAAAATAGG + Intergenic
973048902 4:45570613-45570635 ATTTTTATATTGAATAAGAATGG + Intergenic
973061710 4:45734644-45734666 ATTCTAAAACTTATTAAAAATGG + Intergenic
973705103 4:53573364-53573386 ATACTCATAGTGGTTAAAAATGG + Intronic
974210935 4:58775569-58775591 ATTCTAATATTTATTTAAAGTGG + Intergenic
974609863 4:64203186-64203208 ATTCAAATATTTTTTAAAAAGGG - Intergenic
974980453 4:68950086-68950108 ATTCAGATATTAATTTAAAGGGG - Intronic
975829964 4:78358889-78358911 CTGATGATATTGAGTAAAAAAGG + Intronic
975894275 4:79068200-79068222 ATTATTATATTGAATAAAAGTGG - Intergenic
976600410 4:86933171-86933193 TTTCTGATAATGAATAAAAAAGG - Intronic
976988724 4:91336300-91336322 ATTCTGACAATAATTAAAAATGG - Intronic
977370741 4:96131585-96131607 ATTTTTATAATAATTAAAAAAGG - Intergenic
977732597 4:100371977-100371999 AATTTGATTTTGAATAAAAATGG - Intergenic
978051523 4:104206410-104206432 ATTCTGATTTCTAATAAAAATGG - Intergenic
978875002 4:113629940-113629962 TTTAGGATATTGATTAAGAATGG + Intronic
978950912 4:114558014-114558036 ATGATGATACTGATTAAAATTGG - Intergenic
979484505 4:121255176-121255198 ATTCTGACATTCATTACATAAGG - Intergenic
979623079 4:122817640-122817662 ATTTAGATATTAATTAAAAGGGG - Intergenic
980156456 4:129113864-129113886 AATCTGATATTGAAAAAGAAAGG + Exonic
980245192 4:130229855-130229877 ATTCAGATTTTGTTTACAAATGG - Intergenic
980895717 4:138857939-138857961 ATTCTGAAAATGATTAAAGGTGG - Intergenic
981689585 4:147492403-147492425 ATTCTGATTTTCAGAAAAAAAGG - Intronic
981803297 4:148682918-148682940 TTTCTGATATTGGTGGAAAAAGG + Intergenic
982016983 4:151164445-151164467 AATCTGATATTTATTATAATGGG - Intronic
982045027 4:151435935-151435957 ATTTTGATATTCCATAAAAATGG - Intronic
982222767 4:153139136-153139158 ATTCAGAAATTGACTCAAAATGG - Intergenic
982331698 4:154187979-154188001 AGTATGATACGGATTAAAAATGG - Intergenic
982335778 4:154235997-154236019 ATACTGATCTTGAGTGAAAATGG + Exonic
982477023 4:155866263-155866285 ATACTGTTATTGATGAAAATTGG - Exonic
982605603 4:157513113-157513135 ATTCTGACATTTGTTAAAATAGG - Intergenic
982826914 4:160013718-160013740 CCTCTGATATTGATTCACAAAGG - Intergenic
983114983 4:163803623-163803645 ATTATGATATTGATAATAAAAGG + Intronic
984533859 4:180947907-180947929 AAACTGAAATTAATTAAAAATGG + Intergenic
985882460 5:2649061-2649083 ATTCAGATGTTGAATAATAATGG - Intergenic
986729566 5:10625189-10625211 GTTATGAAATTGATTAAAATGGG - Intronic
987435719 5:17891655-17891677 ATTATGCTTTTGATGAAAAATGG - Intergenic
987648808 5:20713208-20713230 ATTGTGATCGTCATTAAAAAAGG + Intergenic
988011776 5:25497660-25497682 ATTCAGATATTTATTATAAAAGG - Intergenic
988568132 5:32337227-32337249 AGTCTAATATTAATTAAACATGG - Intergenic
988747418 5:34154358-34154380 ATTGTGATCCTCATTAAAAAAGG - Intergenic
989392835 5:40920623-40920645 AGTATTATATTGAATAAAAATGG - Intronic
989769537 5:45127924-45127946 ATTATGTTATGAATTAAAAAGGG + Intergenic
990786761 5:59429743-59429765 ATTCTGATACTACATAAAAAGGG + Intronic
990914167 5:60884775-60884797 ATTCTCATATTAATATAAAATGG - Intronic
991017461 5:61947118-61947140 ATTTTTATATTGATTACAAATGG + Intergenic
991059908 5:62363324-62363346 AATCTCATTTTGATTAAGAAAGG + Intronic
991312951 5:65265159-65265181 AGTCTGATATATATTAAAACAGG + Intronic
991925460 5:71701161-71701183 ATTTTGCTAATGATTAAAAATGG + Intergenic
993231206 5:85239118-85239140 ATGCAAATATTGATTTAAAAGGG + Intergenic
993735097 5:91466777-91466799 ATTATGATATTCATTGAAAAAGG + Intergenic
994596108 5:101837686-101837708 ATTCTTATATTAAATAAAATAGG - Intergenic
994658519 5:102624794-102624816 CTTGAGATATTGATTAAAATTGG + Intergenic
994735740 5:103553278-103553300 ATTCTTAAAATGAATAAAAAAGG + Intronic
995655593 5:114422601-114422623 AGTCTGTTATGGATTACAAATGG + Intronic
995689515 5:114808725-114808747 CTTCTGGAAGTGATTAAAAATGG + Intergenic
996408805 5:123133480-123133502 ATTCTGACTTTTAATAAAAAAGG - Intronic
996592919 5:125168119-125168141 ATTCAAATATTTATGAAAAATGG + Intergenic
996819229 5:127607191-127607213 ATTCTTAGATTAACTAAAAAAGG - Intergenic
998659301 5:144218678-144218700 ATTTTGATAATCATTATAAAAGG - Intronic
998859754 5:146430669-146430691 AATGTGATATTGACTAAAAATGG - Intergenic
999060995 5:148635026-148635048 ATTTTTATATTAATTAATAAGGG - Intronic
999123347 5:149227218-149227240 ACTCTGCTAACGATTAAAAATGG + Intronic
999269338 5:150287405-150287427 AGTCTGAAATTGATTAAACAAGG + Intronic
999707522 5:154287122-154287144 ATTCTGAGATTAATTGAAAGTGG + Intronic
1000072901 5:157757369-157757391 TTTCTGATAATGATCAGAAAAGG - Exonic
1000837958 5:166179325-166179347 ATTCACATATTGATTAGAATTGG + Intergenic
1001059540 5:168476779-168476801 ATTTTTATATAGTTTAAAAAAGG + Intergenic
1001900688 5:175425882-175425904 AGTATGATATTGAATAGAAATGG - Intergenic
1002449925 5:179312941-179312963 ACTCTGATATGGACTAAAAGTGG + Intronic
1003461006 6:6328192-6328214 TTTCTTATATAGCTTAAAAATGG - Intergenic
1004417845 6:15441046-15441068 TTTCTGATACTTATCAAAAAAGG + Intronic
1004667917 6:17765814-17765836 CTTCTGAGATTAATTAGAAATGG - Intronic
1005230450 6:23695756-23695778 ATTCTTCCATGGATTAAAAATGG - Intergenic
1005443024 6:25891849-25891871 ATTTTGATATTAATGAAGAAGGG + Intergenic
1005544907 6:26856566-26856588 ATTGTGATCGTCATTAAAAAAGG - Intergenic
1008378603 6:50819419-50819441 TTTCTGAAATTGATAACAAATGG + Intronic
1008988891 6:57579661-57579683 ATTTTGACATTGATAGAAAAAGG + Intronic
1009015696 6:57898188-57898210 ATTGTGATCGTCATTAAAAAAGG - Intergenic
1009177432 6:60477899-60477921 ATTTTGACATTGATAGAAAAAGG + Intergenic
1009246422 6:61244231-61244253 ATTCTAAGGTTGATTTAAAATGG + Intergenic
1009529890 6:64798854-64798876 ATTCTGCTATTGATTAAATGTGG - Intronic
1009817057 6:68749532-68749554 ATTCTAATGTTGAATAAAAATGG + Intronic
1010197688 6:73256155-73256177 ATTCTAATATTGAATAAAAAAGG - Intronic
1010373137 6:75134848-75134870 ATTGTGGTCTTGAGTAAAAAGGG + Exonic
1010477764 6:76310068-76310090 ATTCTGATTTTTATTTAGAATGG + Intergenic
1010712974 6:79196521-79196543 ATTTAGAAATGGATTAAAAATGG - Intergenic
1011507237 6:88059176-88059198 ATTGTTATATGGATGAAAAAAGG - Intronic
1011796719 6:90962168-90962190 AATGTGATATTGAGTAAAAGAGG - Intergenic
1011826780 6:91316740-91316762 TTTCTAATATTGATTTAAATGGG - Intergenic
1012226934 6:96715430-96715452 GTTCTGAAATGGCTTAAAAATGG + Intergenic
1012512138 6:100014282-100014304 ATTCTGATTTTTAATAACAAAGG + Intergenic
1012976288 6:105784254-105784276 ATTCTGGTATTGCTCCAAAAGGG + Intergenic
1013126976 6:107193265-107193287 ATTCTGATCTTGGTGAAAGAGGG + Intronic
1013965979 6:115955851-115955873 ATTTTGATGTTTATTACAAATGG - Intronic
1013986934 6:116205678-116205700 ATTCTGATTTTGTATTAAAAGGG + Intronic
1014032473 6:116721203-116721225 ATACTGATATTCTTTAAAATAGG + Intronic
1014153917 6:118090040-118090062 ATTCTGAGACTGAGTAAGAATGG + Intronic
1014160814 6:118166074-118166096 ATTCTTATCTTGCCTAAAAATGG - Intronic
1014327084 6:120011660-120011682 TTTGAGATATTGATTAATAAAGG - Intergenic
1014379263 6:120718885-120718907 ATTCTAATTTTGATTAATCATGG - Intergenic
1014734807 6:125080076-125080098 ATACTGATAATTATTTAAAAAGG + Intronic
1014789905 6:125660340-125660362 TTTCAGATATAAATTAAAAATGG + Intergenic
1014960869 6:127682662-127682684 ATTCTGATATTAAGTAGTAAAGG + Intergenic
1015014560 6:128396230-128396252 ATTTTTATTATGATTAAAAATGG - Intronic
1015331368 6:131983238-131983260 ATCCTCATATTAAGTAAAAATGG - Intergenic
1015551504 6:134416953-134416975 ATTCTGATATTTATTACCAAAGG + Intergenic
1015749134 6:136542634-136542656 ATTCTGAAGTTGATTATAGACGG - Intronic
1016167730 6:140968119-140968141 ATTCTGATACGGATAATAAATGG + Intergenic
1016328567 6:142931365-142931387 ATTTTTCTGTTGATTAAAAATGG - Intronic
1016687883 6:146901742-146901764 CTTCTGAAATTGAGTAAGAAAGG - Intergenic
1016746309 6:147584148-147584170 ATGCTGATATTCACTAATAAAGG - Intronic
1016768050 6:147817113-147817135 AGTCTGATGATGATGAAAAAAGG - Intergenic
1016911442 6:149203006-149203028 ATTCTGACATTTGTTAAAAATGG - Intergenic
1017246163 6:152227903-152227925 ATTCTGTTTCTGATCAAAAAGGG + Intronic
1018475687 6:164138594-164138616 GTTCTGCTATTGTTTACAAATGG + Intergenic
1020191622 7:6004075-6004097 ATTTACATATTTATTAAAAACGG + Intronic
1020846500 7:13291173-13291195 ACTCTGCTAGTGATGAAAAATGG + Intergenic
1021515758 7:21484092-21484114 ATTATGAAATCTATTAAAAATGG + Intronic
1023281066 7:38570621-38570643 ATAATGATAGTGATAAAAAATGG + Intronic
1024537380 7:50449589-50449611 ATTCTGTTCTTGATGCAAAACGG + Exonic
1024878614 7:54057554-54057576 AGTATGATATTGAATAAAAGTGG - Intergenic
1026120967 7:67536986-67537008 ATTATGATAATAAATAAAAATGG - Intergenic
1026244237 7:68604336-68604358 ATTCTGATAGTTGGTAAAAATGG - Intergenic
1026745841 7:73011430-73011452 ATTTATATATTTATTAAAAATGG - Intergenic
1026749494 7:73039377-73039399 ATTTATATATTTATTAAAAATGG - Intergenic
1026753142 7:73067523-73067545 ATTTATATATTTATTAAAAATGG - Intergenic
1026756793 7:73095643-73095665 ATTTATATATTTATTAAAAATGG - Intergenic
1027031947 7:74896107-74896129 ATTTATATATTTATTAAAAATGG - Intergenic
1027090613 7:75297777-75297799 ATTTATATATTTATTAAAAATGG + Intergenic
1027094258 7:75325746-75325768 ATTTATATATTTATTAAAAATGG + Intergenic
1027097901 7:75353672-75353694 ATTTATATATTTATTAAAAATGG + Intergenic
1027321446 7:77013873-77013895 ATTTATATATTTATTAAAAATGG - Intergenic
1027325080 7:77041938-77041960 ATTTATATATTTATTAAAAATGG - Intergenic
1027396186 7:77756833-77756855 ACTCTTTTATCGATTAAAAATGG - Intronic
1028796955 7:94913578-94913600 ATTGTGTTATTCATTACAAAGGG - Intronic
1029399005 7:100330566-100330588 ATTTATATATTTATTAAAAATGG + Intergenic
1029661110 7:101962696-101962718 AATCTGAGATTGATGAAATATGG - Intronic
1029881037 7:103810068-103810090 ATTGTGAGATTAATTAAAAGTGG - Intronic
1030161662 7:106515724-106515746 ATTCTGATATTGTTGATTAAGGG - Intergenic
1031546453 7:123055897-123055919 ATTCTGATTTTTAATATAAATGG - Intergenic
1031693185 7:124816321-124816343 ATTGTGATATAGATTGAATAAGG - Intergenic
1031698008 7:124884770-124884792 ATTATGATATTGATCAAGCAAGG + Intronic
1031842954 7:126768754-126768776 ATTATGAAATTGATCAAAAGAGG - Intronic
1031864540 7:127024211-127024233 ATTCTTATAAGGATTAAATAAGG + Intronic
1034644735 7:152635271-152635293 TTTCAGATATTGATAAATAATGG - Intergenic
1034729461 7:153372551-153372573 AATATGATGTTGATTAAAAGTGG - Intergenic
1035540069 8:427472-427494 AGTTTGATATTGATTATGAAAGG - Intronic
1036068879 8:5418080-5418102 ATTGTAAAATTGATCAAAAAAGG + Intergenic
1036245470 8:7112429-7112451 ATTCTGATTCTGATTCTAAAGGG - Intergenic
1037730268 8:21518023-21518045 ATTCTGCTCTTGATTCAGAAGGG - Intergenic
1037849595 8:22316167-22316189 ATTCAGACAGTAATTAAAAATGG + Intronic
1037948568 8:23004439-23004461 ATTCTGACATGGATTATGAAAGG + Exonic
1038108731 8:24468647-24468669 ATGTTGATATTGATACAAAATGG - Intronic
1038922539 8:32100627-32100649 TTTCTTATATTTAATAAAAATGG - Intronic
1039032968 8:33329772-33329794 ATTTTGATATTTCTTATAAATGG + Intergenic
1039324995 8:36475233-36475255 ATTCAGATATTTCTAAAAAAGGG + Intergenic
1039668095 8:39559577-39559599 ACTCAGATGTTGATTGAAAAGGG - Intergenic
1039723993 8:40195690-40195712 ATTCTGATCTTGGTGTAAAAAGG + Intergenic
1040426235 8:47289489-47289511 TTTCTGATATTGGTCAGAAAAGG - Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1040924068 8:52658230-52658252 CTTCTGGTATTAATTTAAAAAGG - Intronic
1041345722 8:56895609-56895631 ATTCTAATATTGATAATAACTGG - Intergenic
1041412009 8:57566681-57566703 ATGCTGATATAGTGTAAAAAAGG + Intergenic
1041425314 8:57714125-57714147 ATTCTGGTTTTTATTAAATAGGG + Intergenic
1041857044 8:62469221-62469243 ATTCTAATCTTGAATAATAATGG + Intronic
1041962020 8:63628962-63628984 ATTTTGATTTTGATTACAACTGG - Intergenic
1042802128 8:72730586-72730608 ATCTTAATATTTATTAAAAAGGG - Intronic
1043888935 8:85634665-85634687 CTTCTGATATAGATTTAATAGGG + Intergenic
1043959804 8:86404381-86404403 ATTCAGATGTTGATATAAAAAGG + Intronic
1045589831 8:103581587-103581609 ACTTTTATATTGATTAAAAGTGG - Intronic
1046089911 8:109489489-109489511 ATTCTGAAAGAGATTATAAAAGG + Intronic
1046341476 8:112863576-112863598 ATTATGAAATTGAATAAGAATGG - Intronic
1046429205 8:114101175-114101197 ATTACCATATTGATTCAAAAAGG - Intergenic
1046868716 8:119180096-119180118 ATTTTTATATTGATTGAACAAGG + Intronic
1047228745 8:122978189-122978211 ATGCTGATATTCATAAAAAGGGG - Intergenic
1048786474 8:138055842-138055864 ATTCTGATATAAATAAAAGAGGG - Intergenic
1050028548 9:1361271-1361293 ATTCTGATACTAATGAAGAATGG - Intergenic
1050090533 9:2014302-2014324 AATCTGGTTTTGATTTAAAAAGG - Intergenic
1050447236 9:5738183-5738205 ATTGTGATAATTTTTAAAAAAGG - Intronic
1050830372 9:10003487-10003509 GTTCTGAATTAGATTAAAAAGGG + Intronic
1050989362 9:12129058-12129080 ATTTTGATATGGATTAAATAAGG + Intergenic
1052183635 9:25562981-25563003 ATAATGATATTTATTAAATAGGG + Intergenic
1052943909 9:34152059-34152081 TTTCTGACATTGATTAGAAGGGG - Intergenic
1053262604 9:36682184-36682206 AGTATGATATTGAATAAAAGTGG + Intergenic
1055090513 9:72360896-72360918 ATTCCGTTAATCATTAAAAAGGG + Intronic
1055161847 9:73139598-73139620 ATTTTAATATTGATTTAAATTGG + Intergenic
1055345662 9:75335110-75335132 ACTTTGATATACATTAAAAAGGG + Intergenic
1055786868 9:79880189-79880211 ATACTGATTTTTCTTAAAAAGGG + Intergenic
1056306197 9:85293041-85293063 ATACTGCAATTGATTTAAAATGG + Intergenic
1056713173 9:89008031-89008053 ATACTTACATTGATTAAAAACGG - Intergenic
1056724397 9:89100622-89100644 AAAGTGATATTGATTACAAAAGG - Intronic
1056748855 9:89330039-89330061 ATTATGATGTTGATGAAAAAAGG + Intronic
1057329466 9:94099441-94099463 AGTCTGCCATTGATTAAACAAGG + Intronic
1057538526 9:95941724-95941746 ATTCTGAGATGGATGAAAAATGG - Intronic
1057785000 9:98080805-98080827 CTTCTGATATTCCTTTAAAATGG - Exonic
1057958417 9:99431413-99431435 GATCTGATATTTATAAAAAAAGG - Intergenic
1058178569 9:101767874-101767896 ATTCTGACATAAATTAAAAAGGG - Intergenic
1058317685 9:103588424-103588446 AATCTGATACTGATTAAATGAGG + Intergenic
1058571945 9:106356341-106356363 ATTATGCTGTTGTTTAAAAAAGG + Intergenic
1058623011 9:106903907-106903929 ATACTGATATTGAATGTAAATGG - Intronic
1059644114 9:116247380-116247402 ATTCTGACATTGTTTGAAAAAGG + Intronic
1059801911 9:117758608-117758630 ATTGTTATTTTGATTAGAAAAGG - Intergenic
1060380263 9:123163474-123163496 ATTCTGATGGTGATGGAAAAGGG - Intronic
1060623055 9:125084781-125084803 ATAATGACATTTATTAAAAAGGG + Intronic
1060778519 9:126394331-126394353 ATTTTTAAATTGGTTAAAAATGG - Intronic
1061319496 9:129819309-129819331 ATACTGATTTTTATTTAAAAAGG + Intronic
1061648832 9:132029628-132029650 ATTATGATATTTAATAAGAAGGG + Intronic
1203747480 Un_GL000218v1:49688-49710 TTTCTGATTTAGATTATAAAAGG - Intergenic
1203562237 Un_KI270744v1:68058-68080 TTTCTGATTTAGATTATAAAAGG + Intergenic
1186068439 X:5791484-5791506 ATTCGAAAATAGATTAAAAATGG + Intergenic
1186458223 X:9727614-9727636 ATTCTGACATTGGTTCCAAAGGG - Intronic
1187599770 X:20815321-20815343 GTTCTGATTATCATTAAAAATGG - Intergenic
1188095406 X:26015272-26015294 ATTCAGAAAATGATTAAAAATGG + Intergenic
1190635921 X:52433859-52433881 ATTCTTTTATTTTTTAAAAAAGG - Intergenic
1192085493 X:68092381-68092403 ATTCTGCTATTTTTCAAAAAAGG + Intronic
1192603956 X:72494125-72494147 ATTCAGATATTCAGTGAAAATGG + Intronic
1192983671 X:76373484-76373506 ATACTGAAATTGTTTAAAATAGG - Intergenic
1193094707 X:77534283-77534305 ATGCTGCTATTAATTTAAAAGGG - Intronic
1194136064 X:90143847-90143869 AATCTAATATTGATTCCAAAAGG + Intergenic
1194387999 X:93280811-93280833 AATCTAATCGTGATTAAAAATGG + Intergenic
1194470076 X:94283608-94283630 ATACTAATATTGAATATAAATGG - Intergenic
1195054093 X:101125916-101125938 ACTCTGATACTCATTAATAATGG + Intronic
1195373894 X:104206544-104206566 ACTCTTATATTGCTTAAAAGTGG - Intergenic
1195623261 X:106980610-106980632 ATTCTTATTTTTTTTAAAAAAGG + Intronic
1196534924 X:116832641-116832663 ATTCTGTTTTTGAATAATAAAGG + Intergenic
1197315291 X:124958430-124958452 ATTCTGATTATCATTAGAAAAGG - Intronic
1198035228 X:132795227-132795249 ATTCTGATATTTCATATAAATGG + Intronic
1200481822 Y:3713925-3713947 AATCTAATATTGATTCCAAAAGG + Intergenic
1201160809 Y:11164672-11164694 TTTCTGATTTAGATTATAAAAGG - Intergenic
1201751186 Y:17433527-17433549 TTTGTGATACTGATAAAAAAAGG + Intergenic
1202275248 Y:23111455-23111477 ACAATGCTATTGATTAAAAATGG + Intergenic
1202290780 Y:23309236-23309258 ACAATGCTATTGATTAAAAATGG - Intergenic