ID: 928507770 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:31971617-31971639 |
| Sequence | CTTTGCAAGGCTGAGGTGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 130286 | |||
| Summary | {0: 3, 1: 95, 2: 2719, 3: 33038, 4: 94431} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 928507770_928507775 | -7 | Left | 928507770 | 2:31971617-31971639 | CCTTCCACCTCAGCCTTGCAAAG | 0: 3 1: 95 2: 2719 3: 33038 4: 94431 |
||
| Right | 928507775 | 2:31971633-31971655 | TGCAAAGTAGCTGGAACTACAGG | 0: 2 1: 62 2: 3606 3: 65180 4: 238303 |
||||
| 928507770_928507777 | 27 | Left | 928507770 | 2:31971617-31971639 | CCTTCCACCTCAGCCTTGCAAAG | 0: 3 1: 95 2: 2719 3: 33038 4: 94431 |
||
| Right | 928507777 | 2:31971667-31971689 | AATTTAAAGAAATACAACTAAGG | 0: 1 1: 0 2: 6 3: 82 4: 802 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 928507770 | Original CRISPR | CTTTGCAAGGCTGAGGTGGA AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||