ID: 928507770

View in Genome Browser
Species Human (GRCh38)
Location 2:31971617-31971639
Sequence CTTTGCAAGGCTGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130286
Summary {0: 3, 1: 95, 2: 2719, 3: 33038, 4: 94431}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928507770_928507775 -7 Left 928507770 2:31971617-31971639 CCTTCCACCTCAGCCTTGCAAAG 0: 3
1: 95
2: 2719
3: 33038
4: 94431
Right 928507775 2:31971633-31971655 TGCAAAGTAGCTGGAACTACAGG 0: 2
1: 62
2: 3606
3: 65180
4: 238303
928507770_928507777 27 Left 928507770 2:31971617-31971639 CCTTCCACCTCAGCCTTGCAAAG 0: 3
1: 95
2: 2719
3: 33038
4: 94431
Right 928507777 2:31971667-31971689 AATTTAAAGAAATACAACTAAGG 0: 1
1: 0
2: 6
3: 82
4: 802

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928507770 Original CRISPR CTTTGCAAGGCTGAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr