ID: 928511550

View in Genome Browser
Species Human (GRCh38)
Location 2:32009246-32009268
Sequence GTCACTGGTCGCCCTACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 51}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928511550_928511555 -7 Left 928511550 2:32009246-32009268 CCTGGTGTAGGGCGACCAGTGAC 0: 1
1: 0
2: 1
3: 2
4: 51
Right 928511555 2:32009262-32009284 CAGTGACTGGGGCGACTGCTCGG 0: 1
1: 0
2: 0
3: 18
4: 128
928511550_928511556 -6 Left 928511550 2:32009246-32009268 CCTGGTGTAGGGCGACCAGTGAC 0: 1
1: 0
2: 1
3: 2
4: 51
Right 928511556 2:32009263-32009285 AGTGACTGGGGCGACTGCTCGGG 0: 1
1: 0
2: 1
3: 10
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928511550 Original CRISPR GTCACTGGTCGCCCTACACC AGG (reversed) Intronic
900230007 1:1551884-1551906 GTCACTGGGCTGCCCACACCGGG - Intronic
900417720 1:2542786-2542808 CTCCCTGGTCCCCCTACACGTGG - Intergenic
900684624 1:3940238-3940260 GTCCCTGGCAGCCCTAAACCAGG + Intergenic
920227033 1:204446566-204446588 GGCAGTGGTCCCCCAACACCAGG + Intronic
922674522 1:227542424-227542446 GTGACCGGTCGCCCTACCCGGGG + Intergenic
1071243479 10:83736870-83736892 GTCACTGTTCTCCCAACCCCAGG - Intergenic
1074124243 10:110515667-110515689 GTCACTGGTCAGCCTACGGCTGG + Intergenic
1074162418 10:110845616-110845638 TTCCCTGGTCCCCCTACCCCAGG + Intergenic
1077066246 11:642186-642208 GTCAGAGGTCGCCCTGCCCCAGG - Intergenic
1078901825 11:15649819-15649841 GTCTCTGGAAGCCCTACATCAGG + Intergenic
1083194861 11:61079855-61079877 GTCCCAGGTCCCCATACACCTGG + Intergenic
1085617672 11:78013759-78013781 TTCACTGGTCGACCCAAACCAGG - Intergenic
1091790988 12:3272130-3272152 GTCACTGGTGGCCCCTGACCTGG - Intronic
1102394643 12:112575475-112575497 GTCCCTCGTCGCCCCACCCCCGG - Intronic
1103901830 12:124307382-124307404 GTCACTGGCTGCCCCACTCCTGG - Intronic
1104891126 12:132140681-132140703 GCCGCTGGTCGTCCTGCACCTGG - Exonic
1125377066 15:39041421-39041443 GTCACTCTTCGCGCTGCACCAGG + Intergenic
1125385130 15:39129180-39129202 GTCACTGTCCACCCTACAGCTGG + Intergenic
1133233013 16:4375166-4375188 GTCACTGGTCTCCCTGCCCTGGG + Intronic
1134216390 16:12320020-12320042 GTCACTGGTCTCCCTGCTCCTGG + Intronic
1157550946 18:48581640-48581662 GTCACTGGCTGCCCGACCCCTGG - Intronic
1161792779 19:6370621-6370643 GTCACTGGTGGCCTTAAATCAGG + Intergenic
1162431530 19:10631732-10631754 CTCACTTGGCGCCCTCCACCAGG - Exonic
1167305124 19:48703696-48703718 GTCAATGTTCTCCCGACACCAGG - Exonic
928511550 2:32009246-32009268 GTCACTGGTCGCCCTACACCAGG - Intronic
929698521 2:44141198-44141220 GTCACTGCTCTCCATACAACTGG - Intergenic
937024012 2:118682534-118682556 GTCCCTGGTCTTCCTACACAGGG - Intergenic
938459266 2:131487107-131487129 GTGACTGATGCCCCTACACCTGG + Intronic
938496696 2:131801657-131801679 GTGACAGGTCGCCCTACCCAGGG + Exonic
938500982 2:131831288-131831310 GTCTCTGCACGCCCAACACCTGG + Intergenic
948047192 2:234952980-234953002 ATCTCTGGGCGCCCGACACCCGG - Intronic
948799217 2:240423808-240423830 GTCACTGGTCGGAATACTCCTGG - Intergenic
1184416057 22:44352542-44352564 GTCACTGGTGCCCCTCCTCCTGG + Intergenic
949861281 3:8507097-8507119 GTGGCTGGTGGCCCTGCACCTGG - Intronic
953464150 3:43105123-43105145 GACACTGGTCGCCCTGCACCTGG + Intronic
954684279 3:52362013-52362035 GTCCCTGGCCGCCCTGCACGTGG - Intronic
960864032 3:122182524-122182546 TTCACTGGTCGGATTACACCTGG - Intergenic
964218800 3:154320835-154320857 TTCACTGGTCCCCCTGAACCAGG + Intronic
969369168 4:6720411-6720433 GAGACTGGTCCCCCCACACCAGG + Intergenic
970836085 4:20409220-20409242 CTCACTTCTCGCCCTACAACAGG + Intronic
979552312 4:122004678-122004700 GTCAGTGGTGGCCCTACCACAGG + Intergenic
982118221 4:152115439-152115461 GTCCCTGTTCTCCCTAAACCAGG + Intergenic
985969355 5:3362753-3362775 GGCACTGGTGTCCCTACTCCAGG - Intergenic
989108046 5:37881745-37881767 CTTACTTGTGGCCCTACACCTGG + Intergenic
1000191353 5:158914081-158914103 GTCCCAGCTCTCCCTACACCAGG - Intronic
1006249374 6:32767972-32767994 GTCACTTTTCGGCTTACACCAGG - Intergenic
1007350641 6:41271171-41271193 ATCACGGATCACCCTACACCTGG + Intronic
1016895385 6:149046320-149046342 GGCAGTGGTGGCCCTACCCCTGG - Intronic
1019682992 7:2363066-2363088 GTCACTGATCGTCATATACCTGG - Exonic
1022617169 7:31943343-31943365 GTCACTGCTCACCAGACACCTGG + Intronic
1027268339 7:76505888-76505910 GTCTCTACTCGCCCCACACCAGG - Exonic
1042515078 8:69650745-69650767 GCCACTGGTGTCCCTGCACCTGG + Intronic
1047811039 8:128409445-128409467 GTCACTGCACCCCCTACCCCAGG + Intergenic
1051153727 9:14116252-14116274 GTCACAGGTCGCACTGCACTGGG + Exonic
1052804605 9:33001647-33001669 GTCACTGGTCGCGATACAGCCGG - Intronic