ID: 928511674

View in Genome Browser
Species Human (GRCh38)
Location 2:32009782-32009804
Sequence CCCGGGAAGGACGGTGTGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928511674_928511688 20 Left 928511674 2:32009782-32009804 CCGGGCACACCGTCCTTCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 928511688 2:32009825-32009847 CGCTTCCTGCAAGCCAGAGGCGG 0: 1
1: 0
2: 1
3: 11
4: 153
928511674_928511687 17 Left 928511674 2:32009782-32009804 CCGGGCACACCGTCCTTCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 928511687 2:32009822-32009844 GCACGCTTCCTGCAAGCCAGAGG 0: 1
1: 0
2: 1
3: 8
4: 104
928511674_928511682 -8 Left 928511674 2:32009782-32009804 CCGGGCACACCGTCCTTCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 928511682 2:32009797-32009819 TTCCCGGGGGTGGCAGCGGCCGG 0: 1
1: 1
2: 1
3: 24
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928511674 Original CRISPR CCCGGGAAGGACGGTGTGCC CGG (reversed) Intronic