ID: 928511679

View in Genome Browser
Species Human (GRCh38)
Location 2:32009791-32009813
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 229}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928511679_928511694 28 Left 928511679 2:32009791-32009813 CCGTCCTTCCCGGGGGTGGCAGC 0: 1
1: 0
2: 0
3: 24
4: 229
Right 928511694 2:32009842-32009864 AGGCGGCGACAAGTCGGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 83
928511679_928511687 8 Left 928511679 2:32009791-32009813 CCGTCCTTCCCGGGGGTGGCAGC 0: 1
1: 0
2: 0
3: 24
4: 229
Right 928511687 2:32009822-32009844 GCACGCTTCCTGCAAGCCAGAGG 0: 1
1: 0
2: 1
3: 8
4: 104
928511679_928511693 27 Left 928511679 2:32009791-32009813 CCGTCCTTCCCGGGGGTGGCAGC 0: 1
1: 0
2: 0
3: 24
4: 229
Right 928511693 2:32009841-32009863 GAGGCGGCGACAAGTCGGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 33
928511679_928511692 26 Left 928511679 2:32009791-32009813 CCGTCCTTCCCGGGGGTGGCAGC 0: 1
1: 0
2: 0
3: 24
4: 229
Right 928511692 2:32009840-32009862 AGAGGCGGCGACAAGTCGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 34
928511679_928511688 11 Left 928511679 2:32009791-32009813 CCGTCCTTCCCGGGGGTGGCAGC 0: 1
1: 0
2: 0
3: 24
4: 229
Right 928511688 2:32009825-32009847 CGCTTCCTGCAAGCCAGAGGCGG 0: 1
1: 0
2: 1
3: 11
4: 153
928511679_928511690 22 Left 928511679 2:32009791-32009813 CCGTCCTTCCCGGGGGTGGCAGC 0: 1
1: 0
2: 0
3: 24
4: 229
Right 928511690 2:32009836-32009858 AGCCAGAGGCGGCGACAAGTCGG 0: 1
1: 0
2: 0
3: 2
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928511679 Original CRISPR GCTGCCACCCCCGGGAAGGA CGG (reversed) Intronic