ID: 928511681

View in Genome Browser
Species Human (GRCh38)
Location 2:32009795-32009817
Sequence GGCCGCTGCCACCCCCGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 6, 3: 21, 4: 250}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928511681_928511690 18 Left 928511681 2:32009795-32009817 CCTTCCCGGGGGTGGCAGCGGCC 0: 1
1: 0
2: 6
3: 21
4: 250
Right 928511690 2:32009836-32009858 AGCCAGAGGCGGCGACAAGTCGG 0: 1
1: 0
2: 0
3: 2
4: 71
928511681_928511687 4 Left 928511681 2:32009795-32009817 CCTTCCCGGGGGTGGCAGCGGCC 0: 1
1: 0
2: 6
3: 21
4: 250
Right 928511687 2:32009822-32009844 GCACGCTTCCTGCAAGCCAGAGG 0: 1
1: 0
2: 1
3: 8
4: 104
928511681_928511688 7 Left 928511681 2:32009795-32009817 CCTTCCCGGGGGTGGCAGCGGCC 0: 1
1: 0
2: 6
3: 21
4: 250
Right 928511688 2:32009825-32009847 CGCTTCCTGCAAGCCAGAGGCGG 0: 1
1: 0
2: 1
3: 11
4: 153
928511681_928511695 29 Left 928511681 2:32009795-32009817 CCTTCCCGGGGGTGGCAGCGGCC 0: 1
1: 0
2: 6
3: 21
4: 250
Right 928511695 2:32009847-32009869 GCGACAAGTCGGCTGGGGTCCGG 0: 1
1: 0
2: 0
3: 5
4: 51
928511681_928511694 24 Left 928511681 2:32009795-32009817 CCTTCCCGGGGGTGGCAGCGGCC 0: 1
1: 0
2: 6
3: 21
4: 250
Right 928511694 2:32009842-32009864 AGGCGGCGACAAGTCGGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 83
928511681_928511693 23 Left 928511681 2:32009795-32009817 CCTTCCCGGGGGTGGCAGCGGCC 0: 1
1: 0
2: 6
3: 21
4: 250
Right 928511693 2:32009841-32009863 GAGGCGGCGACAAGTCGGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 33
928511681_928511696 30 Left 928511681 2:32009795-32009817 CCTTCCCGGGGGTGGCAGCGGCC 0: 1
1: 0
2: 6
3: 21
4: 250
Right 928511696 2:32009848-32009870 CGACAAGTCGGCTGGGGTCCGGG 0: 1
1: 0
2: 0
3: 3
4: 65
928511681_928511692 22 Left 928511681 2:32009795-32009817 CCTTCCCGGGGGTGGCAGCGGCC 0: 1
1: 0
2: 6
3: 21
4: 250
Right 928511692 2:32009840-32009862 AGAGGCGGCGACAAGTCGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928511681 Original CRISPR GGCCGCTGCCACCCCCGGGA AGG (reversed) Intronic