ID: 928511683

View in Genome Browser
Species Human (GRCh38)
Location 2:32009799-32009821
Sequence GGCCGGCCGCTGCCACCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 323}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928511683_928511695 25 Left 928511683 2:32009799-32009821 CCCGGGGGTGGCAGCGGCCGGCC 0: 1
1: 0
2: 1
3: 26
4: 323
Right 928511695 2:32009847-32009869 GCGACAAGTCGGCTGGGGTCCGG 0: 1
1: 0
2: 0
3: 5
4: 51
928511683_928511688 3 Left 928511683 2:32009799-32009821 CCCGGGGGTGGCAGCGGCCGGCC 0: 1
1: 0
2: 1
3: 26
4: 323
Right 928511688 2:32009825-32009847 CGCTTCCTGCAAGCCAGAGGCGG 0: 1
1: 0
2: 1
3: 11
4: 153
928511683_928511694 20 Left 928511683 2:32009799-32009821 CCCGGGGGTGGCAGCGGCCGGCC 0: 1
1: 0
2: 1
3: 26
4: 323
Right 928511694 2:32009842-32009864 AGGCGGCGACAAGTCGGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 83
928511683_928511692 18 Left 928511683 2:32009799-32009821 CCCGGGGGTGGCAGCGGCCGGCC 0: 1
1: 0
2: 1
3: 26
4: 323
Right 928511692 2:32009840-32009862 AGAGGCGGCGACAAGTCGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 34
928511683_928511696 26 Left 928511683 2:32009799-32009821 CCCGGGGGTGGCAGCGGCCGGCC 0: 1
1: 0
2: 1
3: 26
4: 323
Right 928511696 2:32009848-32009870 CGACAAGTCGGCTGGGGTCCGGG 0: 1
1: 0
2: 0
3: 3
4: 65
928511683_928511687 0 Left 928511683 2:32009799-32009821 CCCGGGGGTGGCAGCGGCCGGCC 0: 1
1: 0
2: 1
3: 26
4: 323
Right 928511687 2:32009822-32009844 GCACGCTTCCTGCAAGCCAGAGG 0: 1
1: 0
2: 1
3: 8
4: 104
928511683_928511690 14 Left 928511683 2:32009799-32009821 CCCGGGGGTGGCAGCGGCCGGCC 0: 1
1: 0
2: 1
3: 26
4: 323
Right 928511690 2:32009836-32009858 AGCCAGAGGCGGCGACAAGTCGG 0: 1
1: 0
2: 0
3: 2
4: 71
928511683_928511693 19 Left 928511683 2:32009799-32009821 CCCGGGGGTGGCAGCGGCCGGCC 0: 1
1: 0
2: 1
3: 26
4: 323
Right 928511693 2:32009841-32009863 GAGGCGGCGACAAGTCGGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928511683 Original CRISPR GGCCGGCCGCTGCCACCCCC GGG (reversed) Intronic